A Birkhoff connection between quantum circuits and linear classical reversible circuits

Birkhoff's theorem tells how any doubly stochastic matrix can be decomposed as a weighted sum of permutation matrices. Similar theorems on unitary matrices reveal a connection between quantum circuits and linear classical reversible circuits. It triggers the question whether a quantum computer can be regarded as a superposition of classical reversible computers

ESR Fine Structure of Manganese Ions in Zeolite A Detects Strong Variations of the Coordination Environment

The electron spin resonance spectra of Mn 2+ exchanged zeolite A have been investigated as a function of the monovalent co-cation (K + ,Na + ,Li + ,Cs + ,or NH4 + ), Mn 2+ content, recording frequency, and temperature. Three new Mn 2+ species are observed with a well-resolved fine structure; this allows for the first time a direct quantitative determination of the zero-field splitting (ZFS) parameters in zeolites. In hydrated zeolites, three ESR active Mn 2+ species are observed, characterized by different values for the ZFS parameter D. Species I has D ) 0.035 cm -1 . Species II is closer to a regular octahedron, with D ) 0.010 cm -1 . Species III, with D ) 0.14 cm -1 , is in a strongly axially distorted coordination. Species I is dominant in MnKA, MnCsA, and MnNH4A, while II and III are found in MnNaA and MnLiA. In fully dehydrated zeolites, two species are observed. Species IV has a small hyperfine constant A and is present in dry NaA and KA. Species V is observed in dry LiA; it has axial symmetry with a large, temperature-dependent D. Species V probably represents Mn 2+ in a 3-fold coordination in a 6-ring. In partially hydrated zeolites, a tetrahedral species VI is observed. The spectroscopic data elucidate the location of manganese-( II) ions in zeolite A, particularly at relatively low metal loadings

Detection of REM Sleep Behaviour Disorder by Automated Polysomnography Analysis

Evidence suggests Rapid-Eye-Movement (REM) Sleep Behaviour Disorder (RBD) is an early predictor of Parkinson's disease. This study proposes a fully-automated framework for RBD detection consisting of automated sleep staging followed by RBD identification. Analysis was assessed using a limited polysomnography montage from 53 participants with RBD and 53 age-matched healthy controls. Sleep stage classification was achieved using a Random Forest (RF) classifier and 156 features extracted from electroencephalogram (EEG), electrooculogram (EOG) and electromyogram (EMG) channels. For RBD detection, a RF classifier was trained combining established techniques to quantify muscle atonia with additional features that incorporate sleep architecture and the EMG fractal exponent. Automated multi-state sleep staging achieved a 0.62 Cohen's Kappa score. RBD detection accuracy improved by 10% to 96% (compared to individual established metrics) when using manually annotated sleep staging. Accuracy remained high (92%) when using automated sleep staging. This study outperforms established metrics and demonstrates that incorporating sleep architecture and sleep stage transitions can benefit RBD detection. This study also achieved automated sleep staging with a level of accuracy comparable to manual annotation. This study validates a tractable, fully-automated, and sensitive pipeline for RBD identification that could be translated to wearable take-home technology.Comment: 20 pages, 3 figure

The "quasi-stable" lipid shelled microbubble in response to consecutive ultrasound pulses

Controlled microbubble stability upon exposure to consecutive ultrasound exposures is important for increased sensitivity in contrast enhanced ultrasound diagnostics and manipulation for localised drug release. An ultra high-speed camera operating at 13 × 10 6 frames per second is used to show that a physical instability in the encapsulating lipid shell can be promoted by ultrasound, causing loss of shell material that depends on the characteristics of the microbubble motion. This leads to well characterized disruption, and microbubbles follow an irreversible trajectory through the resonance peak, causing the evolution of specific microbubble spectral signatures. © 2012 American Institute of Physics

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos

Processing prescriptively incorrect comparative particles: Evidence from sentence-matching and eye-tracking

Speakers of a language sometimes use particular constructions which violate prescriptive grammar rules. Despite their prescriptive ungrammaticality, they can occur rather frequently. One such example is the comparative construction in Dutch and similarly in German, where the equative particle is used in comparative constructions instead of the prescriptively correct comparative particle (Dutch beter als Jan and German besser wie Jan ‘lit. better as John’). From a theoretical linguist’s point of view, these so-called grammatical norm violations are perfectly grammatical, even though they are not part of the language’s prescriptive grammar. In a series of three experiments using sentence-matching and eye-tracking methodology, we investigated whether grammatical norm violations are processed as truly grammatical, as truly ungrammatical, or whether they fall in between these two. We hypothesized that the latter would be the case. We analyzed our data using linear mixed effects models in order to capture possible individual differences. The results of the sentence-matching experiments, which were conducted in both Dutch and German, showed that the grammatical norm violation patterns with ungrammatical sentences in both languages. Our hypothesis was therefore not borne out. However, using the more sensitive eye-tracking method on Dutch speakers only, we found that the ungrammatical alternative leads to higher reading times than the grammatical norm violation. We also found significant individual variation regarding this very effect. We furthermore replicated the processing difference between the grammatical norm violation and the prescriptively correct variant. In summary, we conclude that while the results of the more sensitive eye-tracking experiment suggest that grammatical norm violations are not processed on a par with ungrammatical sentences, the results of all three experiments clearly show that grammatical norm violations cannot be considered grammatical, either