954 research outputs found
The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein
Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Publisher PDFPeer reviewe
Coeducational ideas In physical education teachers: Pshycometric properties of a scale
Ante la falta de cuestionarios o escalas que evaluaran los diferentes aspectos coeducativos que caracterizan al profesorado de Educación Física y la necesidad de conocer cuál es la concepción que tienen sobre este modelo, se desprende el objetivo de este trabajo, como el de evaluar las propiedades psicométricas mediante un instrumento que hemos denominado Escala sobre el pensamiento coeducativo del profesorado de EF para valorar las opiniones respecto a la coeducación y la metodología que se utiliza en sus clases. La muestra estuvo compuesta por 213 profesores, 133 hombres y 43 mujeres. La escala fue aplicada mediante papel, envío de correo electrónico y plataforma moddle. El análisis de los datos muestra unos resultados adecuados en cuanto
a estructura factorial, consistencia interna y tipos de validez. Se concluye que esta Escala representa un instrumento válido y fiable para analizar las características coeducativas del profesoradoBecause of the absence of questionnaires or scales which will assess different coeducative aspects that are characteristics of PE teacher and need to know which is the conception that they have about this model, it is deduced the aim of this work as that which evaluate the psychometric properties through a tool called the Scale of coeducational ideas in physical education teachers to value the opinions about coeducation and the methodology used in their classes. The sample was composed by 213 teachers, 133 men and 43 women. The questionnaire was applied by means of paper, electronic mail shipment and platform moddle. The data analysis shows appropriate results in terms of factor structure, internal consistency and validity types. We conclude that the escale represents a valid and reliable instrument to analyze the coeducative characteristics of the teacher
Effects of Exenatide vs. Metformin on endothelial function in obese patients with pre-diabetes: a randomized trial
BACKGROUND: Glucagon like peptide-1 (GLP-1) receptor agonist treatment may improve endothelial function via direct and indirect mechanisms. We compared the acute and chronic effects of the GLP-1 receptor agonist exenatide vs. metformin on endothelial function in patients with obesity and pre-diabetes. METHODS: We performed a randomized, open-label, clinical trial in 50 non-diabetic individuals (mean age 58.5 ± 10.0; 38 females) with abdominal obesity and either impaired fasting glucose, elevated HbA1c, or impaired glucose tolerance (IGT) who were randomized to receive 3-months of exenatide or metformin. Microvascular endothelial function, assessed by digital reactive hyperemia (reactive hyperemic index: RHI), C-reactive protein (CRP), circulating oxidized LDL (oxLDL), and vascular cell adhesion molecule-1 (VCAM-1) were measured at baseline and 3-months. Seven subjects with IGT participated in a sub-study comparing the effects of pre-administration of exenatide and metformin on postprandial endothelial function. RESULTS: There were no differences for the change in RHI (Δ exenatide: 0.01 ± 0.68 vs. Δ metformin: -0.17 ± 0.72, P = 0.348), CRP, oxLDL, or VCAM-1 between exenatide and metformin treatment. Triglycerides were reduced more with exenatide compared to metformin (Δ exenatide: -25.5 ± 45.7 mg/dL vs. Δ metformin: -2.9 ± 22.8 mg/dL, P = 0.032). In the sub-study, there was no difference in postprandial RHI between exenatide and metformin. CONCLUSIONS: Three months of exenatide therapy had similar effects on microvascular endothelial function, markers of inflammation, oxidative stress, and vascular activation, as metformin, in patients with obesity and pre-diabetes. CLINICAL TRIALS REGISTRATION: This study is registered on http://www.clinicaltrials.gov/: NCT0054672
Variable rate spraying in varied micro-meteorological conditions
This study evaluated effects of crosswind on the variable rate sprayer application treatments spray coverage and deposition on different citrus canopy sizes. The axial-fan airblast sprayer retrofitted with variable liquid- and air-assist rates was field-tested with different crosswind conditions on small (about 2 m tall and < 1.5 m wide) and medium-sized (about 3 m tall and < 2.5 m wide) canopies. Crosswinds of 1.3, 2.7, and 4.0 ms-1 on the canopies being sprayed were generated using the stationary conical air shaker as the air blower unit. Water sensitive papers (WSPs) were used to collect droplet deposits and image processing software was used to analyze the WSPs scanned at 600 dpi. Percent spray coverage on the WSPs was found to be one of the most suited parameters to evaluate the effectiveness of spray application treatments. Overall, the variable rate spray application treatments had comparable spray coverage on respective canopies (front, middle, and across WSP locations in the canopy) during all crosswind conditions. For both types of canopies, spray coverage was higher on the canopy front and decreased as the spray penetrated inside (i.e. canopy middle) and across. Due to coalescing, larger droplets (Dv,0.5 [volume median diameter] = 838 to 2,624 µm) were formed on the WSPs located on canopy front, whereas coalescing reduced as the spray penetrated inside (Dv,0.5 = 391 to 1,625 µm on canopy middle) and across the canopy (Dv,0.5 = 307 to 508 µm). Keywords: airblast sprayer, adjustable air-assistance, crosswind, spray coverage, citru
Function of cofactor Akirin2 in the regulation of gene expression in model human Caucasian neutrophil-like HL60 cells
The Akirin family of transcription cofactors are involved throughout the metazoan in the regulation of different biological processes (BPs) such as immunity, interdigital regression, muscle and neural development. Akirin do not have catalytic or DNA-binding capability and exert its regulatory function primarily through interacting proteins such as transcription factors, chromatin remodelers, and RNA-associated proteins. In the present study, we focused on the human Akirin2 regulome and interactome in neutrophil-like model human Caucasian promyelocytic leukemia HL60 cells. Our hypothesis is that metazoan evolved to have Akirin2 functional complements and different Akirin2-mediated mechanisms for the regulation of gene expression. To address this hypothesis, experiments were conducted using transcriptomics, proteomics and systems biology approaches in akirin2 knockdown and wildtype (WT) HL60 cells to characterize Akirin2 gene/protein targets, functional complements and to provide evidence of different mechanisms that may be involved in Akirin2-mediated regulation of gene expression. The results revealed Akirin2 gene/protein targets in multiple BPs with higher representation of immunity and identified immune response genes as candidate Akirin2 functional complements. In addition to linking chromatin remodelers with transcriptional activation, Akirin2 also interacts with histone H3.1 for regulation of gene expression. © 2021 The Author(s)
Visual 3-D SLAM from UAVs
The aim of the paper is to present, test and discuss the implementation of Visual SLAM techniques to images taken from Unmanned Aerial Vehicles (UAVs) outdoors, in partially structured environments. Every issue of the whole process is discussed in order to obtain more accurate localization and mapping from UAVs flights. Firstly, the issues related to the visual features of objects in the scene, their distance to the UAV, and the related image acquisition system and their calibration are evaluated for improving the whole process. Other important, considered issues are related to the image processing techniques, such as interest point detection, the matching procedure and the scaling factor. The whole system has been tested using the COLIBRI mini UAV in partially structured environments. The results that have been obtained for localization, tested against the GPS information of the flights, show that Visual SLAM delivers reliable localization and mapping that makes it suitable for some outdoors applications when flying UAVs
Chromosome-scale and haplotype-resolved genome assembly of a tetraploid potato cultivar
Potato is the most widely produced tuber crop worldwide. However, reconstructing the four haplotypes of its autotetraploid genome remained an unsolved challenge. Here, we report the 3.1 Gb haplotype-resolved (at 99.6% precision), chromosome-scale assembly of the potato cultivar ‘Otava’ based on high-quality long reads, single-cell sequencing of 717 pollen genomes and Hi-C data. Unexpectedly, ~50% of the genome was identical-by-descent due to recent inbreeding, which was contrasted by highly abundant structural rearrangements involving ~20% of the genome. Among 38,214 genes, only 54% were present in all four haplotypes with an average of 3.2 copies per gene. Taking the leaf transcriptome as an example, 11% of the genes were differently expressed in at least one haplotype, where 25% of them were likely regulated through allele-specific DNA methylation. Our work sheds light on the recent breeding history of potato, the functional organization of its tetraploid genome and has the potential to strengthen the future of genomics-assisted breeding
What do we evaluate in sport mindfulness interventions? A systematic review of commonly used questionnaires
Interest of the study: mindfulness is a concept describing the focus on the present moment, intentionally and without judgement. This approach has only recently been applied to sport psychology.
Objectives: the aim of the current review is to investigate which indicators and questionnaires are used in mindfulness research in sport, being specifically interested in mindfulness assessment.
Methods: PRISMA guidelines for systematic reviews and the recommendations of the Cochrane Collaboration were used. Literature searches were conducted in Psychinfo, PubMed, EMBASE and the Cochrane Library.
Results: From 2, 203 records initially retrieved, 17 articles were included. The results show that mindfulness, anxiety and acceptance are the most commonly studied psychological indicators. The Five Facet Mindfulness Questionnaire is the most frequently used mindfulness scale. We also discuss the possibility of using physiological indicators as complementary assessment.
Conclusions: It is recommended to specifically adapt some questionnaires, such is already done with the Sport Anxiety Scale or the Mindfulness Inventory for Sport, for their use in sport psychology
- …