Suppression of genetic recombination in the pseudoautosomal region and at subtelomeres in mice with a hypomorphic Spo11 allele.

International audienceBACKGROUND: Homologous recombination is the key process that generates genetic diversity and drives evolution. SPO11 protein triggers recombination by introducing DNA double stranded breaks at discreet areas of the genome called recombination hotspots. The hotspot locations are largely determined by the DNA binding specificity of the PRDM9 protein in human, mice and most other mammals. In budding yeast Saccharomyces cerevisae, which lacks a Prdm9 gene, meiotic breaks are formed opportunistically in the regions of accessible chromatin, primarily at gene promoters. The genome-wide distribution of hotspots in this organism can be altered by tethering Spo11 protein to Gal4 recognition sequences in the strain expressing Spo11 attached to the DNA binding domain of the Gal4 transcription factor. To establish whether similar re-targeting of meiotic breaks can be achieved in PRDM9-containing organisms we have generated a Gal4BD-Spo11 mouse that expresses SPO11 protein joined to the DNA binding domain of yeast Gal4. RESULTS: We have mapped the genome-wide distribution of the recombination initiation sites in the Gal4BD-Spo11 mice. More than two hundred of the hotspots in these mice were novel and were likely defined by Gal4BD, as the Gal4 consensus motif was clustered around the centers in these hotspots. Surprisingly, meiotic DNA breaks in the Gal4BD-Spo11 mice were significantly depleted near the ends of chromosomes. The effect is particularly striking at the pseudoautosomal region of the X and Y chromosomes -- normally the hottest region in the genome. CONCLUSIONS: Our data suggest that specific, yet-unidentified factors influence the initiation of meiotic recombination at subtelomeric chromosomal regions

A Dominant, Recombination-Defective Allele of Dmc1 Causing Male-Specific Sterility

DMC1 is a meiosis-specific homolog of bacterial RecA and eukaryotic RAD51 that can catalyze homologous DNA strand invasion and D-loop formation in vitro. DMC1-deficient mice and yeast are sterile due to defective meiotic recombination and chromosome synapsis. The authors identified a male dominant sterile allele of Dmc1, Dmc1(Mei11), encoding a missense mutation in the L2 DNA binding domain that abolishes strand invasion activity. Meiosis in male heterozygotes arrests in pachynema, characterized by incomplete chromosome synapsis and no crossing-over. Young heterozygous females have normal litter sizes despite having a decreased oocyte pool, a high incidence of meiosis I abnormalities, and susceptibility to premature ovarian failure. Dmc1(Mei11) exposes a sex difference in recombination in that a significant portion of female oocytes can compensate for DMC1 deficiency to undergo crossing-over and complete gametogenesis. Importantly, these data demonstrate that dominant alleles of meiosis genes can arise and propagate in populations, causing infertility and other reproductive consequences due to meiotic prophase I defects

Fluorescence-detected interactions of oligonucleotides in RecA complexes

AbstractA technique has been developed to probe directly RecA-DNA interactions by the use of the fluorescent chromophore, (+)anti-benzo(a)pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE), covalently attached to DNA. The 24-mer oligonucleotide 5′-d(CTACTAAACATGTACAAATCATCC) was specifically modified on the exocyclic nitrogen of the central guanine, to yield a trans-adduct. Upon interaction of the modified oligonucleotide with RecA we find an increase in BPDE fluorescence and a rather high fluorescence anisotropy, suggesting a restricted motion of the BPDE-oligonucleotide in the protein filament. In the presence of the cofactor ATPγS, binding of two oligonuclotides, identical or complementary in sequence, in the RecA filament is possible. The RecA-DNA complex is, however, more stable when the sequences are complementary; in addition, a shift in the BPDE emission peaks is observed. In the presence of ATP (and an ATP regeneration system), the RecA-DNA interaction between two complementary oligonucleotides is changed, and we now find protein-mediated renaturation to occur

RecA homology search is promoted by mechanical stress along the scanned duplex DNA

A RecA–single-stranded DNA (RecA–ssDNA) filament searches a genome for sequence homology by rapidly binding and unbinding double-stranded DNA (dsDNA) until homology is found. We demonstrate that pulling on the opposite termini (3′ and 5′) of one of the two DNA strands in a dsDNA molecule stabilizes the normally unstable binding of that dsDNA to non-homologous RecA–ssDNA filaments, whereas pulling on the two 3′, the two 5′, or all four termini does not. We propose that the ‘outgoing’ strand in the dsDNA is extended by strong DNA–protein contacts, whereas the ‘complementary’ strand is extended by the tension on the base pairs that connect the ‘complementary’ strand to the ‘outgoing’ strand. The stress resulting from different levels of tension on its constitutive strands causes rapid dsDNA unbinding unless sufficient homology is present

Modeling the early stage of DNA sequence recognition within RecA nucleoprotein filaments

Homologous recombination is a fundamental process enabling the repair of double-strand breaks with a high degree of fidelity. In prokaryotes, it is carried out by RecA nucleofilaments formed on single-stranded DNA (ssDNA). These filaments incorporate genomic sequences that are homologous to the ssDNA and exchange the homologous strands. Due to the highly dynamic character of this process and its rapid propagation along the filament, the sequence recognition and strand exchange mechanism remains unknown at the structural level. The recently published structure of the RecA/DNA filament active for recombination (Chen et al., Mechanism of homologous recombination from the RecA-ssDNA/dsDNA structure, Nature 2008, 453, 489) provides a starting point for new exploration of the system. Here, we investigate the possible geometries of association of the early encounter complex between RecA/ssDNA filament and double-stranded DNA (dsDNA). Due to the huge size of the system and its dense packing, we use a reduced representation for protein and DNA together with state-of-the-art molecular modeling methods, including systematic docking and virtual reality simulations. The results indicate that it is possible for the double-stranded DNA to access the RecA-bound ssDNA while initially retaining its Watson–Crick pairing. They emphasize the importance of RecA L2 loop mobility for both recognition and strand exchange