Body Mass Index in Pregnancy Does Not Affect Peroxisome Proliferator‑activated Receptor Gamma Promoter Region (−359 to −260) Methylation in the Neonate

Background: Obesity in pregnancy can contribute to epigenetic changes.Aim: To assess whether body mass index (BMI) in pregnancy is associated with changes in the methylation of the peroxisome proliferator‑activated receptor γ (PPAR) promoter region (−359 to − 260) in maternal and neonatal leukocytes.Subjects and Methods: In this matched, cohort study 41 pregnant women were allocated into two groups: (a) Normal weight (n = 21) and (b) overweight (n = 20). DNA was extracted from maternal and neonatal leukocytes (4000–10,000 cells) in MagNA Pure (Roche) using MagNA Pure LC DNA Isolation Kit 1 (Roche, Germany). Treatment of DNA (2 μg) was performed with sodium bisulfite (EZ DNA Methylation‑Direct™ Kit; Zymo Research). Real‑time quantitative polymerase chain reaction (qPCR) was performed in a LightCycler 2.0 (Roche) using the SYBR® Advantage® qPCR Premix Kit (Clontech). The primers used for PPARg coactivator (PPARG) M3 were 5’‑aagacggtttggtcgatc‑3’ (forward), and5’‑cgaaaaaaaatccgaaatttaa‑3’ (reverse) and those for PPARG unmethylated were: 5’‑gggaagatggtttggttgatt‑3’ (forward) and 5’‑ttccaaaaaaaaatccaaaatttaa‑3’ (reverse). Intergroup differences were calculated using the Mann–Whitney U‑test, and intragroup differences, with the Wilcoxon test (IBM SPSS Statistics for Windows, Version 19.0. Armonk, NY: IBM Corp.).Results: Significant differences were found in BMI, pregestational weight, and postdelivery weight between groups but not in the methylation status of the PPARγ promoter region (−359 to − 260).Conclusion: The PPARγ promoter region (−359 to − 260) in peripheral leukocytes is unlikely to get an obesity‑induced methylation in pregnancy.Keywords: Body mass index, Methylation, Peroxisome proliferator‑activated receptor gamma, Pregnanc

Declamacion funeral en las segundas solemnes exequias ... a la inmortal memoria de la muy ilustre Señora y Venerable Madre Sor Josepha Manuela de Palafox y Cardona ...

Fecha tomada de licenciasAnteportada con grab. de Sor JosefaPort. con orla tip.13425A-031-174 (2)6, A-C4, D

Exact ground states for the four-electron problem in a Hubbard ladder

The exact ground state of four electrons in an arbitrary large two leg Hubbard ladder is deduced from nine analytic and explicit linear equations. The used procedure is described, and the properties of the ground state are analyzed. The method is based on the construction in r-space of the different type of orthogonal basis wave vectors which span the subspace of the Hilbert space containing the ground state. In order to do this, we start from the possible microconfigurations of the four particles within the system. These microconfigurations are then rotated, translated and spin-reversed in order to build up the basis vectors of the problem. A closed system of nine analytic linear equations is obtained whose secular equation, by its minimum energy solution, provides the ground state energy and the ground state wave function of the model.Comment: 10 pages, 7 figure

Narrative Review: Impairing Emotional Outbursts: What They Are and What We Should Do About Them

Objective: Impairing emotional outbursts, defined by extreme anger or distress in response to relatively ordinary frustrations and disappointments, impact all mental health care systems, emergency departments, schools, and juvenile justice programs. However, the prevalence, outcome, and impact of outbursts are difficult to quantify because they are transdiagnostic and not explicitly defined by current diagnostic nosology. Research variably addresses outbursts under the rubrics of tantrums, anger, irritability, aggression, rage attacks, or emotional and behavioral dysregulation. Consistent methods for identifying and assessing impairing emotional outbursts across development or systems of care are lacking. Method: The American Academy of Child and Adolescent Psychiatry Presidential Task Force (2019-2021) conducted a narrative review addressing impairing emotional outbursts within the limitations of the existing literature and independent of diagnosis. Results: Extrapolating from the existing literature, best estimates suggest that outbursts occur in 4%-10% of community children (preschoolers through adolescents). Impairing emotional outbursts may respond to successful treatment of the primary disorder, especially for some children with attention-deficit/hyperactivity disorder whose medications have been optimized. However, outbursts are generally multi-determined and often represent maladaptive or deficient coping strategies and responses. Conclusion: Evidence-based strategies are necessary to address factors that trigger, reinforce, or excuse the behaviors and to enhance problem-solving skills. Currently available interventions yield only modest effect sizes for treatment effect. More specific definitions and measures are needed to track and quantify outbursts and to design and assess the effectiveness of interventions. Better treatments are clearly needed

Evaluation of the health-related quality of life of children in Schistosoma haematobium-endemic communities in Kenya: a cross-sectional study.

BACKGROUND: Schistosomiasis remains a global public health challenge, with 93% of the ~237 million infections occurring in sub-Saharan Africa. Though rarely fatal, its recurring nature makes it a lifetime disorder with significant chronic health burdens. Much of its negative health impact is due to non-specific conditions such as anemia, undernutrition, pain, exercise intolerance, poor school performance, and decreased work capacity. This makes it difficult to estimate the disease burden specific to schistosomiasis using the standard DALY metric. METHODOLOGY/PRINCIPAL FINDINGS: In our study, we used Pediatric Quality of Life Inventory (PedsQL), a modular instrument available for ages 2-18 years, to assess health-related quality of life (HrQoL) among children living in a Schistosoma haematobium-endemic area in coastal Kenya. The PedsQL questionnaires were administered by interview to children aged 5-18 years (and their parents) in five villages spread across three districts. HrQoL (total score) was significantly lower in villages with high prevalence of S. haematobium (-4.0%, p<0.001) and among the lower socioeconomic quartiles (-2.0%, p<0.05). A greater effect was seen in the psychosocial scales as compared to the physical function scale. In moderate prevalence villages, detection of any parasite eggs in the urine was associated with a significant 2.1% (p<0.05) reduction in total score. The PedsQL reliabilities were generally high (Cronbach alphas ≥0.70), floor effects were acceptable, and identification of children from low socioeconomic standing was valid. CONCLUSIONS/SIGNIFICANCE: We conclude that exposure to urogenital schistosomiasis is associated with a 2-4% reduction in HrQoL. Further research is warranted to determine the reproducibility and responsiveness properties of QoL testing in relation to schistosomiasis. We anticipate that a case definition based on more sensitive parasitological diagnosis among younger children will better define the immediate and long-term HrQoL impact of Schistosoma infection

Relevance of the Diversity among Members of the Trypanosoma Cruzi Trans-Sialidase Family Analyzed with Camelids Single-Domain Antibodies

The sialic acid present in the protective surface mucin coat of Trypanosoma cruzi is added by a membrane anchored trans-sialidase (TcTS), a modified sialidase that is expressed from a large gene family. In this work, we analyzed single domain camelid antibodies produced against trans-sialidase. Llamas were immunized with a recombinant trans-sialidase and inhibitory single-domain antibody fragments were obtained by phage display selection, taking advantage of a screening strategy using an inhibition test instead of the classic binding assay. Four single domain antibodies displaying strong trans-sialidase inhibition activity against the recombinant enzyme were identified. They share the same complementarity-determining region 3 length (17 residues) and have very similar sequences. This result indicates that they likely derived from a unique clone. Probably there is only one structural solution for tight binding inhibitory antibodies against the TcTS used for immunization. To our surprise, this single domain antibody that inhibits the recombinant TcTS, failed to inhibit the enzymatic activity present in parasite extracts. Analysis of individual recombinant trans-sialidases showed that enzymes expressed from different genes were inhibited to different extents (from 8 to 98%) by the llama antibodies. Amino acid changes at key positions are likely to be responsible for the differences in inhibition found among the recombinant enzymes. These results suggest that the presence of a large and diverse trans-sialidase family might be required to prevent the inhibitory response against this essential enzyme and might thus constitute a novel strategy of T. cruzi to evade the host immune system

Agrobacterium tumefaciens-Induced Bacteraemia Does Not Lead to Reporter Gene Expression in Mouse Organs

Agrobacterium tumefaciens is the main plant biotechnology gene transfer tool with host range which can be extended to non-plant eukaryotic organisms under laboratory conditions. Known medical cases of Agrobacterium species isolation from bloodstream infections necessitate the assessment of biosafety-related risks of A. tumefaciens encounters with mammalian organisms. Here, we studied the survival of A. tumefaciens in bloodstream of mice injected with bacterial cultures. Bacterial titers of 108 CFU were detected in the blood of the injected animals up to two weeks after intravenous injection. Agrobacteria carrying Cauliflower mosaic virus (CaMV) 35S promoter-based constructs and isolated from the injected mice retained their capacity to promote green fluorescent protein (GFP) synthesis in Nicotiana benthamiana leaves. To examine whether or not the injected agrobacteria are able to express in mouse organs, we used an intron-containing GFP (GFPi) reporter driven either by a cytomegalovirus (CMV) promoter or by a CaMV 35S promoter. Western and northern blot analyses as well as RT-PCR analysis of liver, spleen and lung of mice injected with A. tumefaciens detected neither GFP protein nor its transcripts. Thus, bacteraemia induced in mice by A. tumefaciens does not lead to detectible levels of genetic transformation of mouse organs

Reconstructing the three-dimensional GABAergic microcircuit of the striatum

A system's wiring constrains its dynamics, yet modelling of neural structures often overlooks the specific networks formed by their neurons. We developed an approach for constructing anatomically realistic networks and reconstructed the GABAergic microcircuit formed by the medium spiny neurons (MSNs) and fast-spiking interneurons (FSIs) of the adult rat striatum. We grew dendrite and axon models for these neurons and extracted probabilities for the presence of these neurites as a function of distance from the soma. From these, we found the probabilities of intersection between the neurites of two neurons given their inter-somatic distance, and used these to construct three-dimensional striatal networks. The MSN dendrite models predicted that half of all dendritic spines are within 100 mu m of the soma. The constructed networks predict distributions of gap junctions between FSI dendrites, synaptic contacts between MSNs, and synaptic inputs from FSIs to MSNs that are consistent with current estimates. The models predict that to achieve this, FSIs should be at most 1% of the striatal population. They also show that the striatum is sparsely connected: FSI-MSN and MSN-MSN contacts respectively form 7% and 1.7% of all possible connections. The models predict two striking network properties: the dominant GABAergic input to a MSN arises from neurons with somas at the edge of its dendritic field; and FSIs are interconnected on two different spatial scales: locally by gap junctions and distally by synapses. We show that both properties influence striatal dynamics: the most potent inhibition of a MSN arises from a region of striatum at the edge of its dendritic field; and the combination of local gap junction and distal synaptic networks between FSIs sets a robust input-output regime for the MSN population. Our models thus intimately link striatal micro-anatomy to its dynamics, providing a biologically grounded platform for further study

Genome of the Avirulent Human-Infective Trypanosome—Trypanosoma rangeli

Background: Trypanosoma rangeli is a hemoflagellate protozoan parasite infecting humans and other wild and domestic mammals across Central and South America. It does not cause human disease, but it can be mistaken for the etiologic agent of Chagas disease, Trypanosoma cruzi. We have sequenced the T. rangeli genome to provide new tools for elucidating the distinct and intriguing biology of this species and the key pathways related to interaction with its arthropod and mammalian hosts.  Methodology/Principal Findings: The T. rangeli haploid genome is ,24 Mb in length, and is the smallest and least repetitive trypanosomatid genome sequenced thus far. This parasite genome has shorter subtelomeric sequences compared to those of T. cruzi and T. brucei; displays intraspecific karyotype variability and lacks minichromosomes. Of the predicted 7,613 protein coding sequences, functional annotations could be determined for 2,415, while 5,043 are hypothetical proteins, some with evidence of protein expression. 7,101 genes (93%) are shared with other trypanosomatids that infect humans. An ortholog of the dcl2 gene involved in the T. brucei RNAi pathway was found in T. rangeli, but the RNAi machinery is non-functional since the other genes in this pathway are pseudogenized. T. rangeli is highly susceptible to oxidative stress, a phenotype that may be explained by a smaller number of anti-oxidant defense enzymes and heatshock proteins.  Conclusions/Significance: Phylogenetic comparison of nuclear and mitochondrial genes indicates that T. rangeli and T. cruzi are equidistant from T. brucei. In addition to revealing new aspects of trypanosome co-evolution within the vertebrate and invertebrate hosts, comparative genomic analysis with pathogenic trypanosomatids provides valuable new information that can be further explored with the aim of developing better diagnostic tools and/or therapeutic targets

Antisense-Mediated Knockdown of NaV1.8, but Not NaV1.9, Generates Inhibitory Effects on Complete Freund's Adjuvant-Induced Inflammatory Pain in Rat

Tetrodotoxin-resistant (TTX-R) sodium channels NaV1.8 and NaV1.9 in sensory neurons were known as key pain modulators. Comparing with the widely reported NaV1.8, roles of NaV1.9 on inflammatory pain are poorly studied by antisense-induced specific gene knockdown. Here, we used molecular, electrophysiological and behavioral methods to examine the effects of antisense oligodeoxynucleotide (AS ODN) targeting NaV1.8 and NaV1.9 on inflammatory pain. Following complete Freund's adjuvant (CFA) inflammation treatment, NaV1.8 and NaV1.9 in rat dorsal root ganglion (DRG) up-regulated mRNA and protein expressions and increased sodium current densities. Immunohistochemical data demonstrated that NaV1.8 mainly localized in medium and small-sized DRG neurons, whereas NaV1.9 only expressed in small-sized DRG neurons. Intrathecal (i.t.) delivery of AS ODN was used to down-regulate NaV1.8 or NaV1.9 expressions confirmed by immunohistochemistry and western blot. Unexpectedly, behavioral tests showed that only NaV1.8 AS ODN, but not NaV1.9 AS ODN could reverse CFA-induced heat and mechanical hypersensitivity. Our data indicated that TTX-R sodium channels NaV1.8 and NaV1.9 in primary sensory neurons played distinct roles in CFA-induced inflammatory pain and suggested that antisense oligodeoxynucleotide-mediated blocking of key pain modulator might point toward a potential treatment strategy against certain types of inflammatory pain