Experimental Approach for Bacterial Strains Characterization

In plant biology, data acquisition is no longer necessarily a major problem but nevertheless the treatment and the use of these data are still difficult. In this work, we are particularly interested by the characterization of strains of phytopathogenic bacterias, which is an important issue in the study of plant diseases. We study and compare several methods computing the smallest possible characterizations. These experiments have allowed us to characterize specific strains and diagnosis tests have been produced and used

Characterization of Multiple Groups of Data

In this paper we propose a new approach for computing characterizations of sets of data by means of partially defined Boolean functions. The main objective is to provide minimal sets of characters that allows the user to discriminate groups of Boolean data representing individuals described by means of presence or absence of characters. Compared to previous approaches, our algorithms are more efficient and are able to compute complete sets of solutions, which may be useful according to our underlying application domain in plant biology

The bacterial strains characterization problem

The accurate characterization of collections of bacterial strains is a major scientific challenge, since bacteria are indeed responsible of significant plant diseases and thus subjected to official control procedures (e.g., in Europe, Directive 2000/29/EC). The development of diagnostic tests is therefore an important issue in order to routinely identify strains of these species

Cost of cataract surgery after implantation of three intraocular lenses

Catherine Boureau1, Antoine Lafuma2, Viviane Jeanbat2, Andrew F Smith3, Gilles Berdeaux41Clinique Geoffroy St Hilaire, Paris, France; 2Cemka-Eval, Bourg la Reine, France; 3Alcon Laboratories Ltd, Hemel Hempstead, UK and Nuffield Laboratory of Ophthalmology, University of Oxford, UK; 4Alcon France, Rueil Malmaison, France; Conservatoire National des Arts et Métiers, Paris, FranceBackground: Posterior capsule opacification is one of the most frequent adverse events following cataract surgery. This manuscript reports the lifetime cost of complications linked to posterior capsule opacification using three types of intraocular lens with square edges.Methods: Costs were estimated from a retrospective study of patients who underwent cataract surgery and data from the literature. The lenses studied were hydrophobic acrylic (SA60AT and AR40E) and hydrophilic acrylic (XL-Stabi) lenses with square edges. The frequency of Nd-Yag laser capsulotomies after 4 years’ survival was estimated by two methods: the first involved linear adjustment of the rate at 5 and 6 years follow-up and then application of a constant rate after 6 years; the second involved linear adjustment after 5 years follow-up. The economic perspective was that of the French Sickness Fund.Results: After 3 years’ follow-up the percentage of patients who had not undergone laser Nd-Yag capsulotomy was 86.9% with SA60AT, 76.6% with AR40E and 54.6% with XL-Stabi lenses (p < 0.001). The total cost of capsulotomy and management of complications per patient lifetime was estimated to be €90.5 for SA60AT, €189.5 for AR40E and €288.0 for XL-Stabi lenses by the first extrapolation method. With the second method of extrapolation the costs were €94.8, €200.0 and €300.2, respectively.Interpretation: Lower costs for cataract surgery and management of related complications were observed with the two hydrophobic acrylic lenses; the lowest costs were observed with SA60AT lenses as they were associated with fewer Nd-Yag laser capsulotomies.Keywords: cataract surgery, Nd-Yag laser, capsulotomy, adverse event, cost, budget impac

Procédé de dépistage de Xanthomonas axonopodis pv. phaseoli

Screening Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprises detecting a combination (C1) of two genes of the combination AvrBsT/Xac3090, the combination AvrBsT/XopP, and the combination AvrBsT/AvrXccB, where the result of the screening process is positive if the presence of two genes of the combination (C1) is detected in the biological sample. Independent claims are included for: (1) a nucleotide probe or primer used in a method of screening Xanthomonas axonopodis pathovar phaseoli, where the primer or the probe has a length of 12-30 nucleotides and comprising at least 12 consecutive nucleotides from a nucleic acid of the nucleic acid sequence of SEQ ID NOs: 5-12 (e.g. ccatgctgagcacggtcatt (SEQ ID NO: 5), cgccttccagttgctgacat (SEQ ID NO: 6), acgagcccttcccaaactagc (SEQ ID NO: 7), taccaacatcgtacgcttccc (SEQ ID NO: 8), cgtcagtgagtgctcggttg (SEQ ID NO: 9) and tcagagccctggaagcaaga (SEQ ID NO: 10)), and the nucleic acids of complementary sequence; and (2) a kit for detection of Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprising two pairs of primers for amplifying the combination of the two genes (C1) and the nucleotide probe or primer

Accelerated algorithm for computation of all prime patterns in logical analysis of data

The analysis of groups of binary data can be achieved by logical based approaches. These approaches identify subsets of relevant Boolean variables to characterize observations and may help the user to better understand their properties. In logical analysis of data, given two groups of data, patterns of Boolean values are used to discriminate observations in these groups. In this work, our purpose is to highlight that different techniques may be used to compute these patterns. We present a new approach to compute prime patterns that do not provide redundant information. Experiments are conducted on real biological data

Logical characterization of groups of data: a comparative study

This paper presents an approach for characterizing groups of data represented by Boolean vectors. The purpose is to find minimal set of attributes that allow to distinguish data from different groups. In this work, we precisely defined the multiple characterization problem and the algorithms that can be used to solve its different variants. Our data characterization approach can be related to Logical Analysis of Data and we propose thus a comparison between these two methodologies. The purpose of this paper is also to precisely study the properties of the solutions that are computed with regards to the topological properties of the instances. Experiments are thus conducted on real biological data

Zoonosis emergence linked to agricultural intensification and environmental change

A systematic review was conducted by a multidisciplinary team to analyze qualitatively best available scientific evidence on the effect of agricultural intensification and environmental changes on the risk of zoonoses for which there are epidemiological interactions between wildlife and livestock. The study found several examples in which agricultural intensification and/or environmental change were associated with an increased risk of zoonotic disease emergence, driven by the impact of an expanding human population and changing human behavior on the environment. We conclude that the rate of future zoonotic disease emergence or reemergence will be closely linked to the evolution of the agriculture–environment nexus. However, available research inadequately addresses the complexity and interrelatedness of environmental, biological, economic, and social dimensions of zoonotic pathogen emergence, which significantly limits our ability to predict, prevent, and respond to zoonotic disease emergence

A multiplex-PCR assay for identification of the quarantine plant pathogen Xanthomonas axonopodis pv. phaseoli

In this study we developed an algorithm to screen for all exact molecular signatures of the quarantine pathogen Xanthomonas axonopodis pv. phaseoli (Xap), based on available data of the presence or absence of virulence-associated genes. The simultaneous presence of genes avrBsT and xopL is specific to Xap. Therefore we developed a multiplex PCR assay targeting avrBsT and xopL for the molecular identification of Xap. The specificity of this multiplex was validated by comparison to that of other molecular identification assays aimed at Xap, on a wide collection of reference strains. This multiplex was further validated on a blind collection of Xanthomonas isolates for which pathogenicity was assayed by stem wounding and by dipping leaves into calibrated inocula. This multiplex was combined to the previously described X4c/X4e molecular identification assay for Xap. Such a combination enables the molecular identification of all strains of Xanthomonas pathogenic on bean. Results also show that assay by stem wounding does not give reliable results in the case of Xap, and that pathogenicity assays by dipping should be preferred