The Roles of H2S Gas in Behavior of Carbon Steel Corrosion in Oil and Gas Environment: a Review

Hydrogen sulfide (H2S) is the most dangerous element which exists in oil and gas reservoir. H2S acidifies water which causes pitting corrosion to carbon steel pipelines. Corrosion reaction will increase fast when it combines with oxygen and carbon dioxide (CO2). Thus, they can significantly reduce service life of transportation pipelines and processing facilities in oil and gas industries. Understanding corrosion mechanism of H2S is crucial to study since many severe deterioration of carbon steels pipelines found in oil and gas industries facilities. To investigate H2S corrosion accurately, it requires studying physical, electrical and chemical properties of the environment. This paper concentrates, especially, on carbon steel corrosion caused by H2S gas. How this gas reacts with carbon steel in oil and gas reservoir is also discussed. This paper also reviews the developments of corrosion prediction software of H2S corrosion. The corrosion mechanism of H2S combined with CO2 gas is also in focused

Proses Amplifikasi Daerah Promoter Inha Padaisolat P11mycobacterium Tuberculosis Multidrug Resistance Di Bali Dengan Teknik Polymerase Chain Reaction

Saat ini, Multidrug resistance Mycobacterium tuberculosis (MDR-TB) menjadi salah satu masalah kesehatan di dunia. Resistensi terhadap isoniazid dapat dipengaruhi oleh mutasi pada daerah promoter inhA. Untuk memperoleh titik mutasi di daerah promoter inhA maka terlebih dahulu dilakukan amplifikasi fragmen DNA target. Penelitian ini bertujuan untuk mengetahui suhu annealing optimum primer yang dapat mengamplifikasi fragmen target daerah promoter inhA. Fragmen target diamplifikasi dengan teknik PCR menggunakan sepasang primer yaitu primer forward (mabA-inhA-promoter-FS) dengan urutan 5'ACATACCTGCTGCGCAAT3' dan primer reverse (mabA-inhA-promoter-R) dengan urutan 5'CTCCGGTAACCAGGACTGAA3'. Dari hasil penelitian menunjukkan bahwa sepasang primer yang digunakan pada suhu annealing 54º telah dapat mengamplifikasi fragmen 0,3 kb daerah promoter inhA

Mechanistic model of stress corrosion cracking (scc) of carbon steel in acidic solution with the presence of H2s

In oil and gas industrial environments, H2S gas is one of the corrosive species which should be a main concern in designing infrastructure made of carbon steel. Combination between the corrosive environment and stress condition will cause degradation of carbon steel increase unpredictably due to their simultaneous effects. This paper will design a model that involves electrochemical and mechanical theories to study crack growth rate under presence of H2S gas. Combination crack and corrosion propagation of carbon steel, with different hydrogen concentration has been investigated. The results indicated that high concentration of hydrogen ions showed a higher crack propagation rate. The comparison between corrosion prediction models and corrosion model developed by researchers used to verify the model accuracy showed a good agreement

Corrosion prediction for corrosion rate of carbon steel in oil and gas environment: a review

Corrosion predictions are essential for corrosion and material engineers. It is used to prepare pre-Front End Engineering Design (pre-FEED). FEED guides to select appropriate materials, planning test schedule, work over management, and estimate future repair for cost analyses. Corrosion predictions also calculate life of pipeline and equipment systems during operational stages. As oil and gas environments are corrosive for carbon steel, it is important to account the corrosion rate of carbon steels in those environmental conditions. There are many existing corrosion predictions software, which are available in oil and gas industries. However, corrosion predictions only can be used for particular ranges of environmental conditions because they use different input parameters. To select the most applicable of corrosion predictions software, engineers have to understand theoretical background and fundamental concept of the software. This paper reviews the applications of existing corrosion prediction software in calculating corrosion rate of carbon steel in oil and gas environmental systems. The concept philosophy of software is discussed. Parameters used and range of conditions are also studied. From the results of studies, there are limitations and beneficial impacts in using corrosion software. Engineers should understand the fundamental theories of the corrosion mechanism. Knowing limitations of the models, the appropriate model can be correctly selected and interpretation of corrosion rate will close to the real data conditions

Predicting effects of corrosion erosion of high strength steel pipelines elbow on CO2-Acetic Acid (HAc) solution

Simultaneously effect of erosion combined with corrosion becomes the most concern in oil and gas industries. It is due to the fast deterioration of metal as effects of solid particles mixed with corrosive environment. There are many corrosion software to investigate possible degradation mechanisms developed by researchers. They are using many combination factors of chemical reactions and physical process. However effects of CO2 and acid on pipelines orientations are still remain uncovered in their simulation. This research will investigate combination effects of CO2 and HAc on corrosion and erosion artificial environmental containing sands particles in 45o , 90o and 180o elbow pipelines. The research used theoretical calculations combined with experiments for verification. The main concerns are to investigate the maximum erosion corrosion rate and maximum shear stress at the surface. Methodology used to calculate corrosion rate are Linear Polarization Resistance (LPR) and weight loss. The results showed that at 45ᵒ, erosion rate is the more significant effects in contributing degradation of the metal. The effects of CO2 and HAc gave significant effects when flow rate of the solution are high which reflect synergism effects of solid particles and those chemical compositions

Caffeine as A Natural Corrosion Inhibitor for Mild Steel in Nacl Solution

Corrosion inhibitors are substances that added to the environment in small concentration and can effectively reduce the corrosion rate that of a metal surface. Natural inhibitors are one types of inhibitor being researched as it brings less environmental impact on the environment. This research was focused on the application of caffeine as inhibitor for corrosion of mild steel in seawater condition. The objective of this project was to develop the relationship between caffeine concentration on the corrosion of mild carbon steel in both static and moving solution contained 3.5-wt% NaCl. Three types of solution were prepared, which are NaCl without addition of caffeine, NaCl with 1-wt% of caffeine and NaCl with 2-wt% of caffeine. Corrosion testing was carried out by weight loss measurement. The microstructures of corroded mild steel specimens were observed under optical microscope. The experimental results indicated that by adding caffeine into the environment medium, weight loss of mild steel specimen was reduced. The corrosion rate of specimens was decreased when more caffeine was added to the environment. From optical microscopic observation, caffeine performed its inhibition effect likely by forming a protective layer which acts as barrier to prevent further corrosion of mild steel in NaCl solution

Critical Role of Intermediaries on Technology Transfer: Case Study of BIOTROP and Center for Mariculture Development of Lampung

. Relationship among technology generator and technology user is one of factors determining successful technology transfer, but the existence of intermediaries is proven to enhance the absorptive capacity of technology user, especially in rural areas. Government can enact as intermediary by supporting the relationship generator-user, which is commonly found in agriculture and fishery sectors. The aim of this study is to demonstrate how government can support technology transfer from academic institution to rural industry. Using case study method, this study focused on the critical role of Center for Mariculture Development of Lampung (CMDL) which acts as an intermediary of technology transfer process from Southeast Asian Ministers of Education Organization- Southeast Asian Regional Center for Tropical Biology (SEAMEO-BIOTROP) to seaweed farmers. This study shows that intermediary agent plays an important role in articulating demand from technology user to technology generator, creating network between adopter-generator, and providing resources (fund, technician, industrial-scale laboratory) for technology commercialization. Intermediary with strong commitment to deliver technology to society is highly needed in successful technology transfer

Morphology Evaluation of ZrO2 Dip Coating on Mild Steel and its Corrosion Performance in NaOH Solution

In this work, the morphology of ZrO2 thin film from dip coating process on mild steel has been investigated. Mild steel was dip-coated on solution made of zirconium butoxide as a precursor, ethanol as solvent, acetylacetone as chelating agent and water for hydrolysis. Number of dipping was adjusted at 3, 5 and 7 times. The dipped sample then annealed at 350°C for two hours by adjusting the heating rate at 1°C/min respectively. The optical microscope showed that micro-cracks were observed on the surface of the coating with its concentration reduced as dipping sequence increased. The XRD result showed that annealing process can produce polycrystalline tetragonal-ZrO2. Meanwhile, SEM image showed that the thicknesses of the ZrO2 coatings were in between 400-600 nm. The corrosion resistance of uncoated and coated substrates was studied by polarization test through potentio-dynamic polarization curve at 1mV/s immersed in with 3.5% NaCl. The coating efficiency was improved as the number of layer dip coated increased, which showed improvement in corrosion protection

Aluminum alloy AA2024 coated with ZrO2 using a sol-gel-assisted dip-coating technique and its corrosion performance

Aluminum alloys has been widely used in most of engineering applications, such as marine industries and aerospace, due to its light weight and durability properties. In the aggressive environment, aluminum alloy becomes chemically reactive and losses its corrosion resistance that can significantly limit to its applications. One of the approaches that have been studied in this research is to improve the corrosion resistance of aluminum alloy by adding zirconium oxide (ZrO2) film coating. In the experimental procedure, aluminum alloy was dipcoated into the solution containing zirconium butoxide (as a precursor) in a specific solvent (consisting of acetone, ethanol, and nitric acid). Dipping process was conducted at different dipping-numbers, which are 3, 5, and 7 dipping number. After dip-coating process, the coated aluminum was annealed at 350°C for 3 hours. X-ray diffraction analysis confirmed that the coating film consists of tetragonal ZrO2. Then, increases in dipping number improved the surface quality of the coating layer, where number of cracks and black spots reduced continuously with higher dipping number. This condition gave positive impacts on the corrosion performance of the aluminum, where higher dipping number brings better corrosion protection in NaCl solution

Crossover of the high-energy spin fluctuations from collective triplons to localized magnetic excitations in doped Sr14-xCaxCu24O41 cuprate ladders

We studied the magnetic excitations in the quasi-one-dimensional (q-1D) ladder subsystem of Sr_(14-x) Ca_x Cu_24 O_41(SCCO) using Cu L_3-edge resonant inelastic X-ray scattering (RIXS). By comparing momentum-resolved RIXS spectra with (x=12.2) and without (x=0) high Ca content, we track the evolution of the magnetic excitations from collective two-triplon (2T) excitations (x=0) to weakly-dispersive gapped modes at an energy of 280 meV (x=12.2). Density matrix renormalization group (DMRG) calculations of the RIXS response in the doped ladders suggest that the flat magnetic dispersion and damped excitation profile observed at x=12.2 originates from enhanced hole localization. This interpretation is supported by polarization-dependent RIXS measurements, where we disentangle the spin-conserving {\Delta}S=0 scattering from the predominant {\Delta}S=1 spin-flip signal in the RIXS spectra. The results show that the low-energy weight in the {\Delta}S=0 channel is depleted when Sr is replaced by Ca, consistent with a reduced carrier mobility. Our results demonstrate that off-ladder impurities can affect both the low-energy magnetic excitations and superconducting correlations in the CuO_4 plaquettes. Finally, our study characterizes the magnetic and charge fluctuations in the phase from which superconductivity emerges in SCCO at elevated pressures