The Thrift of Avian Influenza in Indonesia

The circulating H5N1 Highly Pathogenic Avian Influenza in chicken has created devastating problems in Indonesia since 2003. Although human cases of Avian Influenza could be exceptionally reduced, however, it remains unsettled in poultry. Phylogenetic analysis of H5N1 virus (2003–2011) revealed the introduction of a single ancestral of 2.1 HA clade before 2003. The enzootic clade subsequently evolved into fourth order with predominantly 2.1.3.2. Pathological lesions showed cyanotic wattle, torticollis and haemorrhage in chicken feet and multi-internal organs. However, the introduction of vaccination and stringent biosecurity resulted in milder manifestations compared to classical lesions. In 2012, unusual high mortality in duck farms revealed the introduction of exotic clade 2.3.2.1. Despite the inefficient transmission of avian virus to humans and experimental receptor binding of 2.3.2.1 virus that showed avian preference, substitution of N158D and E190D in HA gene indicates possible threat to humans. In the same year, the Government of Indonesia announced the introduction of H9N2. Furthermore, a recent publication (2018) has reported new reassortant between HPAIV H5N1 and LPAIV H3N8 with resulting virulence attenuation in chicken

Hormon Gnrh Untuk Pendewasaan Kelamin Burung Merpati

ABSTRAK Percobaab mengenai penggunaan GnRh (Gonadotrophine Releasing Hormon) dilakukan di Laboratorium Parasitologi Fakultas Kedoklteran Hewan Universitas Gadjah Mada untuk mempercepat pendewasaan kelamin pada burung merpati (Columbalivia). Percobaan dilakukan terhadap delapan belas ekor burung merpati yang diberi perlakuan GnRH secara intramusculer. Hewan-hewan tersebut dibagi menjadi tiga kelompok, masing-masing terdiri dari enam ekor. Kelompok pertama sebagai kontrol, kelompok kedua diberi perlakuan GnRH sebanyak 10 11 g, dan kelompok ketiga sebanyak 20 pig. Hasil penelitian dianalisis secara deskriptif dan tampak adanya pengaruh positif pada kelompok kedua dan ketiga, namun di antara kedua kelompok tersebut tidak terdapat perbedaan yang nyata

Current Symptoms and Pathological Changes of Bursa Fabricius from Commercial Farming Broilers Led to Infectious Bursal Disease

Infectious Bursal Disease (IBD) or Gumboro is caused by the IBD virus of the Birnaviridae family. The disease is acute and highly contagious in young birds. The virus infection causes severe damage to the lymphoid organs i.e. bursa Fabricius leading to immunosuppression. The disease morbidity may reach 100%, while the mortality varies from 20 to 100%, causing high economic losses. Infectious Bursal Disease has remained significant threat although vaccination has been applied. This study aimed to determine the current typical pathological changes in the bursa Fabricius of commercial broilers showing IBD symptoms. The samples were obtained from commercial broiler farms in Sragen, Wonogiri, Batang, and Sleman. Gross lesion examination showed enlargement of the bursa Fabricius with gelatinous material on the serosal surface, oedema with fluid accumulation in the lumen, hemorrhages of the serosal surface, atrophy, and caseous exudate in the lumen. Histopathologic changes of acute IBD include hemorrhages, congestion, lymphocyte necrosis, accumulation of fibrin, oedematous and heterophils infiltration in the interfollicular tissues. Microscopic changes in chronic IBD (5-7 days post infection IBDV) including follicular atrophy, lymphocyte necrosis, vacuolization of the follicle, and proliferation of fibroblast and connective tissue in the interfollicular space.   In conclusion, the notable pathological change description of    bursa Fabricius in suspected acute is gross lesion (swelling and edema, thickened and enlarged plica bursa Fabricius, hemorraghe), microscopic lesion (congestion, hemorraghe, heterophil infiltration) or chronically IBD infection in broiler chicken was gross lesion (atrophy bursa Fabricius, atrophy and excudate casouse in the lumen bursa Fabricius), microscopic lesion (lymphocyte necrosis, vacuolization of bursa Fabricius follicles, proliferation of fibroblasts and interfollicular connective tissue)

Profil Reseptor Gonadotropini Releasing Hormone (GnRH) dari Hipothalamus Sapi

Gonadotropine Releasing Hormone (GnRH) is one of the recommended hormones to overcome ovulation problems and it can increase pregnancy rate so that it is used in government programs to increase cattle population in Indonesia, although the results are not yet optimal. Hormone and receptor compatibility is the main key to succesful hormone application while data on the composition of the Indonesian cow GnRHreceptors is not yet known. The purpose of this study was to obtain the composition of GnRH receptors cattle in Indonesia and compare them to the GenBank sequence reference so that is known whether genetic diversity occurs at GnRH receptors cattle in Indonesia. Samples in the form of 3 female cow hypothalamus stored at -800C temperatue freezer. The methods used are mRNA isolation, cDNA synthesis,  implification of GnRH gene using Polymerase Chain Reaction (PCR) process by Promoter F and Exon 1 R primers and then elektrophoresis and sent for sequencing. Sequencing product were further aligned with the reference sequences of Bos TaurusGnRHR mRNA GenBank using the MEGA X program. The results of the analysis found the presence of Single Nucleotide Polymorphism (SNP) in the coding region of 1st cow position 38(A> T), 261(C > T), 342(C >T), 411(C >T) and 495(C > T) and 2nd cow positions 261(C >T). Changes in amino acids were also detected in 1stcowposition 13 (H> L). The presence of SNP was found to indicate genomic variation between individuals at GnRH receptors cattle in Indonesia

Molecular Study on The Pathogenicity of Avian Influenza Virus

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny

The Development of Pathogenicity of Avian Influenza Virus Isolated from Indonesia

Highly pathogenic avian infl uenza outbreak in Indonesia has been reported in various poultry due toH5N1 subtype. The presence of multiple basic amino acids within the cleavage site of HA glycoprotein hasbeen identifi ed to be associated with the pathogenicity of avian infl uenza virus. The study was retrospectivestudy which was designed to characterize the cleavage site and fusion site region of haemagglutinin gene ofAIV isolated from various poultry in 2003 to 2013. Isolation, Identifi cation and propagation were carried outto collect viral stock. For virus detection, reverse transcriptase PCR (RT-PCR) method on H5 and N1 genefragment was performed. All of RT-PCR HA gene positive products were sequenced for further nucleotideanalysis and to determine the nucleotide composition at the targeted fragment. The results are all AIV isolateswere identifi ed as H5N1 subtype. The sequence analyses revealed some motives of basic amino acid motivethat were classifi ed as highly pathogenic avian infl uenza virus. Further analyses on fusion domain of all AIVisolated during the period 2003 to 2013 showed conserved amino acid.Keywords: avian infl uenza, haemagglutinin, cleavage site, basic amino acid, fusion site</div

The Development of Pathogenicity of Avian Influenza Virus Isolated from Indonesia

Highly pathogenic avian infl uenza outbreak in Indonesia has been reported in various poultry due toH5N1 subtype. The presence of multiple basic amino acids within the cleavage site of HA glycoprotein hasbeen identifi ed to be associated with the pathogenicity of avian infl uenza virus. The study was retrospectivestudy which was designed to characterize the cleavage site and fusion site region of haemagglutinin gene ofAIV isolated from various poultry in 2003 to 2013. Isolation, Identifi cation and propagation were carried outto collect viral stock. For virus detection, reverse transcriptase PCR (RT-PCR) method on H5 and N1 genefragment was performed. All of RT-PCR HA gene positive products were sequenced for further nucleotideanalysis and to determine the nucleotide composition at the targeted fragment. The results are all AIV isolateswere identifi ed as H5N1 subtype. The sequence analyses revealed some motives of basic amino acid motivethat were classifi ed as highly pathogenic avian infl uenza virus. Further analyses on fusion domain of all AIVisolated during the period 2003 to 2013 showed conserved amino acid. Keywords: avian infl uenza, haemagglutinin, cleavage site, basic amino acid, fusion sit

Rapid testing of antibiotic residues to increase food safety awareness of animal origin

Background and Aim: Antibiotics are used to improve growth, reduce disease, and decrease mortality in animals grown for food. The government regulates and prohibits the use of antibiotics, in particular, the use of antibiotic growth promoter (AGP) in livestock; however, it is not yet known whether the use of antibiotics is in accordance with regulations so that there are no antibiotic residues in food of animal origin. To ensure food safety of animal origin and to raise awareness of food safety, it is necessary to detect antibiotic residues in fish, eggs, and chicken meat from Yogyakarta Special Province through monitoring and monitoring. To ensure food safety and regulatory compliance in food samples, antibiotic residue screening techniques are essential. A number of methods, such as time-consuming and costly chromatographic and spectroscopic methods, have been developed for the detection of antibiotic residues in food samples; however, not all laboratories have these facilities. Therefore, a rapid diagnosis of food of animal origin is required. The purpose of this study was to rapidly test antibiotic residues by using Premi®test kits (R-Biopharm AG, Germany) to increase awareness of food safety of animal origin. Materials and Methods: We tested 345 animal-based food samples from traditional markets, supermarkets, and central markets in five districts of Yogyakarta Special Province for antibiotic residues using rapid test kits and observation questionnaires to identify risk factors. Results: The presence of antibiotic residues in food-animal origin samples from the Yogyakarta region had an antibiotic residue level of 9.28% (32/345), consisting of fish samples 11.3% (18/97), eggs 15.65% (1/114), and chicken meat samples 0.87% (13/102). The highest percentage of samples positive for residual antibiotics was 21.9% (7/32) from supermarket meat samples. The highest amounts of antibiotic residues were found in fish samples collected from Sleman Regency, up to 25% (8/32), whereas in supermarket fish samples, there were as high as 18.8% (6/32). Conclusion: Antibiotic residues in animal-based food can be attributed to various factors, including product source, transportation conditions, and environmental conditions. The widespread distribution of antibiotic residues in fish comes from environmental conditions during maintenance, distribution, and retailing. Monitoring antibiotic residue prevalence in food-animal origins, particularly chicken meat, eggs, and fish, is crucial for improving animal food quality and safety

Detection of Antibiotic Residues in Chicken Meat and Eggs from Traditional Markets at Yogyakarta City Using Bioassay Method

Studies on antibiotic residues content in food of animal origin are currently needed to support veterinary public health programs. The present study was described bioassay method for the detection of antibiotic residues in chicken meat and eggs from traditional market at Yogyakarta City. A number of twenty-four chicken meat samples and 24 egg samples were taken from 8 traditional markets in Yogyakarta city. Samples were examined at Centre for Veterinary Wates, Yogyakarta, Indonesia using bioassay method for screening detection of penicillin, aminoglycoside, macrolide and tetracycline residues. This bioassay method using some bacteria, such as Bacillus stearothermophillus, B. cereus, B. subtilis, and Kocuria rizophila. A percentage of the results showed that 8.33% (2/24) samples of chickens tested positively contained the oxytetracycline antibiotic residues. Meanwhile, as much as 75% (18/24) samples of positive eggs contain penicillin antibiotic residues, positive residues of aminoglycoside amounted to 12.5% (3/24) and the positive residues of oxytetracycline also amounted to 12.5% (3/24)

Examination of the H5N1 avian influenza virus epitopes for differentiation between infected and vaccinated animals

© 2015 Dr. Maria Theresia Khrisdiana PutriAvian Influenza Virus H5N1 has been a significant pathogen in veterinary and public health since it first appearance in 1996, particularly in countries such as Indonesia where the virus has become endemic. The disease eradication by vaccination has reduced the risk of clinical disease and mortality in the poultry flocks, however full protection has not been achieved. Furthermore, monitoring new infection by serological method has been challenging due to difficulties to discriminate between vaccinated and infected animals (DIVA). Viral proteins M2e and HA2 have been shown to have potential as a DIVA antigen, and are likely to be useful in AIV control in countries where AIV is endemic. The potential of M2e protein for DIVA has been extensively studied previously. In chapter 2 of this study, a library of rabbit antibody against chicken M2e was constructed in the phagemid pSEX81, but several attempts to recover a clone containing the target fragment were unsuccessful. In chapter 3 to 5 of this study, the potency of HA subunit 2 (HA2) protein for DIVA in chicken was examined. This was initially done by epitope mapping the entire HA2 of consensus sequence of Indonesian avian H5N1 strains, using several overlapping recombinant proteins and sera obtained from infected and vaccinated chickens. From this study, a protein spanning aa positions 380-461 (H5 numbering) or 49-130 (HA2 numbering) was found antigenic but reacted strongly with both infected and vaccinated chicken sera. Another protein spanning aa positions 483-565 (H5 numbering) or 152-234 (HA2 numbering) was found to react strongly with infected chicken sera but less strongly with vaccinated chicken sera, indicating the existence of DIVA epitope. This finding was consistent with a report by Khurana, et al., (2011) who identified that a peptide (refer as E29) encompassing aa positions 488-516 of H5 was suitable as a DIVA antigen in human. In order to characterise the potential of the E29 epitope as a DIVA in chickens, several regions of the E29 peptide including aa 492-505 (refer as E15) predicted to be highly immunogenic were produced and examined. The results suggested that aa positions 492Y, 501E, 502E, 503I, 504S and 505G were important for binding of mouse anti-E15 monoclonal antibody while aa positions 495A to 505G were important for binding of monospecific anti-E15 chicken antibodies. The capacity of E29 and E15 as DIVA antigens in chicken was further examined using synthetic (both modified and unmodified) peptides and a limited number of reference sera obtained from experimentally infected or vaccinated chicken sera in ELISA. After optimisation of ELISA conditions, the E29 was found to exhibit the greatest discrimination power compared to other antigen forms between vaccinated and infected chicken sera. The newly developed E29 ELISA was then evaluated against a large number of field sera collected from infected or vaccinated sera and shown to have potential as a DIVA. The finding described in this thesis form the basis for future investigations on application of HA2 epitopes as DIVA reagent for better control of AI in Indonesia and other countries where AIV is endemic, and are ultimately expected to reduce socioeconomical losses incurred due to AI globally