38 research outputs found
Expressão temporal de genes alfa, beta e gama durante a infecção pelo BoHV-5
Herpesvirus bovino 5 é um alfaherpesvírus causador de meningoencefalite não supurativa em bovinos. Esta doença possui ocorrência natural em surtos ou casos isolados, associadas a baixa morbidade e alta letalidade. Embora estudos anteriores tenham elucidado aspectos relacionados a patogenia da doença, há uma lacuna de conhecimento relacionado aos eventos moleculares que contribuem para a infecção e replicação do BoHV-5. O objetivo do presente estudo foi determinar a expressão gênica in vitro de genes virais (i.e., alfa, beta e gama) e das células hospedeiras (GAPDH e 18S) durante a infecção considerando diferentes momentos de infecção e quantidade de vírus utilizado. Três genes do BoHV-5 (bICP0, UL9, US4), um gene estrutural (GAPDH) e um gene constitutivo (18S) da célula bovina tiveram suas expressões avaliadas por PCR quantitativa (qPCR). Enquanto os genes virais tiveram sua expressão aumentada ao longo do tempo de infecção, o gene hospedeiro teve sua expressão diminuída, demonstrando a ação do vírus na expressão gênica de células bovinas in vitro. O gene constitutivo 18S teve sua expressão mantida durante todos os momentos do experimento. Nossos resultados claramente demonstraram que o GAPDH não deve ser usado como gene de referência em estudos com infecção por BoHV-5 pois é influenciado pela infecção viral. Entretanto, o 18S rRNA foi constitutivamente expresso e pode ser recomendado para normalização em células bovinas infectadas pelo vírus. A expressão de mRNA viral não foi alterada pela quantidade de vírus usada. Todos os genes virais demonstraram o mesmo padrão de expressão ao longo do tempo de infecção. Nossos resultados trazem importantes diferenças comparando aos estudos clássicos que avaliaram a expressão de genes alfa, beta e gama. Mais estudos são necessários para aumentar o conhecimento da biologia molecular do BoHV-5. Estudo utilizando sequenciamento de última geração (i.e., RNA-seq), usando modelos in vitro e in vivo, aparentam ser o próximo passo lógico para acessar as alterações do transcriptoma do hospedeiro e viral ao longo do curso da infecção.Bovine herpesvirus 5 is an alphaherpesvirus that causes nonsuppurative meningoencephalitis in cattle. This disease occurs naturally in either outbreaks or isolated cases, and exhibits low morbidity and high lethality. Although previous studies elucidated crucial aspects involved in the pathogenesis of the disease, there is a paucity of information regarding the molecular events contributing to infection and replication of BoHV-5. The objective of the present study was to determine the in vitro gene expression pattern of BoHV-5 (e.g., alpha, beta, and gamma genes) and host cells genes (GAPDH and 18S) over time utilizing different quantities of inoculated virus. Three BoHV-5 genes (bICP0, UL9, US4) and one structural bovine cell gene had their expression accessed by real-time PCR. While the expression of BoHV-5 genes increased during the course of infection, GAPDH gene expression decreased in the host cells, evidencing the effect of viral infection on the expression of bovine cell genes. The 18S ribosomal RNA (rRNA) gene was constitutively expressed throughout BoHV-5 infection. Our data clearly demonstrates that GAPDH gene should not be used as a reference gene in studies of BoHV-5 infection because it was influenced by viral infection. However, 18S rRNA was constitutively expressed and, therefore, is recommended for normalization of BoHV-5 infection studies in bovine cells. The expression of viral genes transcripts was not altered by increasing number of viral particles added to the culture. All viral genes included here demonstrated the same expression pattern over time and there was no difference in the expression of viral genes among the various time points. Our data show important differences comparing to classical studies regarding herpesvirus alpha, beta, and gamma genes expression. More research is necessary to improve our understanding about the BoHV-5 biology during infection. Studies employing next-generation sequencing (i.e., RNA-seq), using both in vitro and in vivo models, would be the next logical step to grasp the virus and host cell’s transcriptome changes over the course of infection
Rede de atenção psicossocial: adequação dos papéis e funções desempenhados pelos profissionais
Objetivo: Verificar a adequação dos papéis e funções desempenhados pelos profissionais de nível superior nos serviços da rede de atenção psicossocial de uma capital do Nordeste brasileiro.Método: Estudo analítico, transversal, de abordagem quantitativa. A amostra foi composta por 65 profissionais de sete serviços da rede de atenção psicossocial de Natal, Rio Grande do Norte, Brasil. Utilizou-se um questionário com perguntas fechadas e semiabertas. Os dados foram analisados através do SPSS versão 20.0, com aplicação dos testes Qui-quadrado e exato de Fisher. Adotou-se nível de significância de 5% (p<0.05).Resultados: detectou-se inadequação quanto ao atendimento aos grupos de familiares (52.3%), à formação especializada em saúde mental (69.2%; p=0,02) e às condições de trabalho nos serviços (87.7%).Conclusão: Os papéis e as funções desenvolvidas pelos profissionais nos serviços pesquisados estavam condizentes com a proposta desses serviços, embora convivendo com inúmeras dificuldades.Palavras-chave: Saúde mental. Serviços de saúde mental. Recursos humanos em saúde. Enfermagem. Papel profissional
Rapid antidepressant effects of the psychedelic ayahuasca in treatment-resistant depression: a randomized placebo-controlled trial
Background
Recent open-label trials show that psychedelics, such as ayahuasca, hold promise as fast-onset antidepressants in treatment-resistant depression.
Methods
To test the antidepressant effects of ayahuasca, we conducted a parallel-arm, double-blind randomized placebo-controlled trial in 29 patients with treatment-resistant depression. Patients received a single dose of either ayahuasca or placebo. We assessed changes in depression severity with the Montgomery-Åsberg Depression Rating Scale (MADRS) and the Hamilton Depression Rating scale at baseline, and at 1 (D1), 2 (D2), and 7 (D7) days after dosing.
Results
We observed significant antidepressant effects of ayahuasca when compared with placebo at all-time points. MADRS scores were significantly lower in the ayahuasca group compared with placebo at D1 and D2 (p = 0.04), and at D7 (p < 0.0001). Between-group effect sizes increased from D1 to D7 (D1: Cohen's d = 0.84; D2: Cohen's d = 0.84; D7: Cohen's d = 1.49). Response rates were high for both groups at D1 and D2, and significantly higher in the ayahuasca group at D7 (64% v. 27%; p = 0.04). Remission rate showed a trend toward significance at D7 (36% v. 7%, p = 0.054).
Conclusions
To our knowledge, this is the first controlled trial to test a psychedelic substance in treatment-resistant depression. Overall, this study brings new evidence supporting the safety and therapeutic value of ayahuasca, dosed within an appropriate setting, to help treat depression. This study is registered at http://clinicaltrials.gov (NCT02914769)
COMPLICAÇÕES DA DERIVAÇÃO VENTRÍCULO-PERITONEAL EM PACIENTES PEDIÁTRICOS: UMA REVISÃO INTEGRATIVA
Introduction: Hydrocephalus is characterized by the accumulation of cerebrospinal fluid (CSF) in the cerebral ventricular system, leading to increased intracranial pressure and dilatation of the ventricles. In children, it is manifested by irritability, accelerated growth of the head circumference, and signs of intracranial hypertension. Ventriculoperitoneal shunt (PVD) is a common surgical technique for CSF drainage. Objective: To analyze the complications associated with PVD in pediatric patients, identifying risk factors, patterns of occurrence, and clinical outcomes, to improve care and clinical outcomes. Methodology: An integrative review was carried out in consultation with PubMed and SciELO. Descriptors such as "ventriculoperitoneal shunt," "complications," "hydrocephalus," "infection," and "malfunction" were used. Articles from the last five years, in Portuguese and English, addressing complications of PVD were included. Out-of-scope, full-text, and duplicate studies were excluded. A total of 11 articles were selected for analysis. Results: We included 11 articles that highlighted complications such as infections, device malfunctions, obstructions, and abdominal complications. Shunt infections occur in up to 15% of pediatric cases, often within the first 6 to 12 months postoperatively. Distal catheter malfunction is common and requires frequent surgical revisions. Rare complications include abdominal pseudocysts, distal catheter extrusion, and gram-negative bacterial infections, with high rates in the first few days after shunt insertion. Frequent revisions increase the risk of complications. Conclusions: PVD, although effective, has several complications that impact the quality of life of pediatric patients. Infections and system malfunctions are the most common complications. Multidisciplinary management and preventive strategies are essential to optimize clinical outcomes and quality of life for patients.Introducción: La hidrocefalia se caracteriza por la acumulación de líquido cefalorraquídeo (LCR) en el sistema ventricular cerebral, lo que conduce a un aumento de la presión intracraneal y a la dilatación de los ventrículos. En los niños, se manifiesta por irritabilidad, crecimiento acelerado de la circunferencia cefálica y signos de hipertensión intracraneal. La derivación ventriculoperitoneal (PVD, por sus siglas en inglés) es una técnica quirúrgica común para el drenaje del LCR. Objetivo: Analizar las complicaciones asociadas a la EVP en pacientes pediátricos, identificando factores de riesgo, patrones de ocurrencia y resultados clínicos, para mejorar la atención y los resultados clínicos. Metodología: Se realizó una revisión integradora en consulta con PubMed y SciELO. Se utilizaron descriptores como "derivación ventriculoperitoneal", "complicaciones", "hidrocefalia", "infección" y "disfunción". Se incluyeron artículos de los últimos cinco años, en portugués e inglés, que abordaron las complicaciones de la EVP. Se excluyeron los estudios fuera de alcance, de texto completo y duplicados. Se seleccionaron un total de 11 artículos para el análisis. Resultados: Se incluyeron 11 artículos que destacaron complicaciones como infecciones, mal funcionamiento del dispositivo, obstrucciones y complicaciones abdominales. Las infecciones por derivación ocurren hasta en el 15% de los casos pediátricos, a menudo dentro de los primeros 6 a 12 meses después de la operación. El mal funcionamiento del catéter distal es común y requiere revisiones quirúrgicas frecuentes. Las complicaciones raras incluyen pseudoquistes abdominales, extrusión de catéter distal e infecciones bacterianas gramnegativas, con tasas altas en los primeros días después de la inserción de la derivación. Las revisiones frecuentes aumentan el riesgo de complicaciones. Conclusiones: La EVP, aunque efectiva, tiene varias complicaciones que impactan en la calidad de vida de los pacientes pediátricos. Las infecciones y el mal funcionamiento del sistema son las complicaciones más comunes. El manejo multidisciplinario y las estrategias preventivas son esenciales para optimizar los resultados clínicos y la calidad de vida de los pacientes.Introdução: A hidrocefalia é caracterizada pelo acúmulo de líquido cefalorraquidiano (LCR) no sistema ventricular cerebral, levando ao aumento da pressão intracraniana e dilatação dos ventrículos. Em crianças, manifesta-se por irritabilidade, crescimento acelerado do perímetro cefálico e sinais de hipertensão intracraniana. A derivação ventrículo-peritoneal (DVP) é uma técnica cirúrgica comum para drenagem do LCR. Objetivo: Analisar as complicações associadas à DVP em pacientes pediátricos, identificando fatores de risco, padrões de ocorrência e desfechos clínicos, para melhorar os cuidados e resultados clínicos. Metodologia: Realizou-se uma revisão integrativa consultando PubMed e SciELO. Utilizaram-se descritores como "ventriculoperitoneal shunt," "complications," "hydrocephalus," "infection," e "malfunction". Foram incluídos artigos dos últimos cinco anos, em português e inglês, abordando complicações da DVP. Excluíram-se estudos fora do escopo, não disponíveis em texto completo e duplicados. Selecionaram-se 11 artigos para análise. Resultados: Foram integrados 11 artigos que destacaram complicações como infecções, mau funcionamento do dispositivo, obstruções e complicações abdominais. Infecções de shunt ocorrem em até 15% dos casos pediátricos, frequentemente nos primeiros 6 a 12 meses pós-cirurgia. O mau funcionamento do cateter distal é comum e requer revisões cirúrgicas frequentes. Complicações raras incluem pseudocistos abdominais, extrusão distal do cateter e infecções bacterianas gram-negativas, com altas taxas nos primeiros dias após a inserção do shunt. Revisões frequentes aumentam o risco de complicações. Conclusões: A DVP, embora eficaz, apresenta várias complicações que impactam a qualidade de vida dos pacientes pediátricos. Infecções e mau funcionamento do sistema são as complicações mais comuns. A gestão multidisciplinar e estratégias preventivas são essenciais para otimizar os resultados clínicos e a qualidade de vida dos pacientes
Identificação de espécies e genótipos de Cryptosporidium em bovinos leiteiros no Brasil
In this study, we identified Cryptosporidium species and genotypes present in dairy cattle in the central region of São Paulo state, Brazil. Fecal specimens were collected from 200 animals (100 calves and 100 cows) in ten dairy farms. Fecal samples were examined using microscopic examination (ME), enzyme immunoassay (EIA) and polymerase chain reaction (PCR). Cryptosporidium species and genotypes were determined by restriction fragment length polymorphism (RFLP) or DNA sequencing analysis of the SSU-rRNA and GP60 genes. The occurrence of Cryptosporidium spp. infection was 14% (28/200). The occurrence in calves (26%) was significantly higher than in cows (2%). Of the 27 Cryptosporidium-positive specimens submitted to genotyping, C. andersoni was identified in 23 (85.1%), C. bovis in three (11.1%), and the zoonotic C. parvum subtype IIaA15G2R1 in one (3.7%). The study demonstrates that Cryptosporidium spp. infection was common and widespread in dairy cattle in this region and that calves have a high prevalence of C. andersoni. Furthermore, the presence of C. parvum subtype IIaA15G2R1 indicates that dairy calves from this region should be considered a potential source of zoonotic Cryptosporidium oocysts.Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP
Identification of Cryptosporidium species and genotypes in dairy cattle in Brazil Identificação de espécies e genótipos de Cryptosporidium em bovinos leiteiros no Brasil
In this study, we identified Cryptosporidium species and genotypes present in dairy cattle in the central region of São Paulo state, Brazil. Fecal specimens were collected from 200 animals (100 calves and 100 cows) in ten dairy farms. Fecal samples were examined using microscopic examination (ME), enzyme immunoassay (EIA) and polymerase chain reaction (PCR). Cryptosporidium species and genotypes were determined by restriction fragment length polymorphism (RFLP) or DNA sequencing analysis of the SSU-rRNA and GP60 genes. The occurrence of Cryptosporidium spp. infection was 14% (28/200). The occurrence in calves (26%) was significantly higher than in cows (2%). Of the 27 Cryptosporidium-positive specimens submitted to genotyping, C. andersoni was identified in 23 (85.1%), C. bovis in three (11.1%), and the zoonotic C. parvum subtype IIaA15G2R1 in one (3.7%). The study demonstrates that Cryptosporidium spp. infection was common and widespread in dairy cattle in this region and that calves have a high prevalence of C. andersoni. Furthermore, the presence of C. parvum subtype IIaA15G2R1 indicates that dairy calves from this region should be considered a potential source of zoonotic Cryptosporidium oocysts.<br>No presente estudo foram identificadas espécies e genótipos de Cryptosporidium originadas de bovinos leiteiros na região central do estado de São Paulo, Brasil. Amostras fecais foram coletadas de 200 animais (100 bezerros e 100 vacas) em 10 propriedades leiteiras. As amostras foram examinadas utilizando os métodos de microscopia óptica (MO), ensaio imunoenzimático (EI) e reação em cadeia da polimerase (PCR). As espécies e genótipos de Cryptosporidium foram determinados pelo método de polimorfismo no tamanho dos fragmentos de restrição (RFLP) ou sequenciamento dos genes SSU-rRNA e GP60. A infecção por Cryptosporidium spp. teve ocorrência de 14% (28/200). A ocorrência em bezerros (26%) foi significativamente maior do que em vacas (2%). Do total de 27 amostras positivas submetidas à caracterização genética, C. andersoni foi identificado em 23 (85.1%), C. bovis em três (11.1%) e C. parvum subtipo IIaA15G2R1 em uma (3.7%). O presente estudo demonstrou que a infecção por Cyptosporidium é comum e difundida em bovinos leiteiros nessa região e que bezerros possuem uma alta prevalência de C. andersoni. A presença de C. parvum subtipo IIaA15G2R1 indica que bezerros leiteiros dessa região devem ser considerados uma fonte de oocistos de Cryptosporidium com potencial zoonótico
Identification of Cryptosporidiumspecies and genotypes in dairy cattle in Brazil
In this study, we identified Cryptosporidium species and genotypes present in dairy cattle in the central region of São Paulo state, Brazil. Fecal specimens were collected from 200 animals (100 calves and 100 cows) in ten dairy farms. Fecal samples were examined using microscopic examination (ME), enzyme immunoassay (EIA) and polymerase chain reaction (PCR). Cryptosporidiumspecies and genotypes were determined by restriction fragment length polymorphism (RFLP) or DNA sequencing analysis of the SSU-rRNA and GP60 genes. The occurrence of Cryptosporidium spp. infection was 14% (28/200). The occurrence in calves (26%) was significantly higher than in cows (2%). Of the 27 Cryptosporidium-positive specimens submitted to genotyping, C. andersoni was identified in 23 (85.1%), C. bovis in three (11.1%), and the zoonotic C. parvum subtype IIaA15G2R1 in one (3.7%). The study demonstrates thatCryptosporidium spp. infection was common and widespread in dairy cattle in this region and that calves have a high prevalence of C. andersoni. Furthermore, the presence of C. parvumsubtype IIaA15G2R1 indicates that dairy calves from this region should be considered a potential source of zoonotic Cryptosporidiumoocysts
Canine distemper virus detection by different methods of One-Step RT-qPCR
ABSTRACT: Three commercial kits of One-Step RT-qPCR were evaluated for the molecular diagnosis of Canine Distemper Virus. Using the kit that showed better performance, two systems of Real-time RT-PCR (RT-qPCR) assays were tested and compared for analytical sensitivity to Canine Distemper Virus RNA detection: a One-Step RT-qPCR (system A) and a One-Step RT-qPCR combined with NESTED-qPCR (system B). Limits of detection for both systems were determined using a serial dilution of Canine Distemper Virus synthetic RNA or a positive urine sample. In addition, the same urine sample was tested using samples with prior centrifugation or ultracentrifugation. Commercial kits of One-Step RT-qPCR assays detected canine distemper virus RNA in 10 (100%) urine samples from symptomatic animals tested. The One-Step RT-qPCR kit that showed better results was used to evaluate the analytical sensitivity of the A and B systems. Limit of detection using synthetic RNA for the system A was 11 RNA copies µL-1 and 110 RNA copies µl-1 for first round System B. The second round of the NESTED-qPCR for System B had a limit of detection of 11 copies µl-1. Relationship between Ct values and RNA concentration was linear. The RNA extracted from the urine dilutions was detected in dilutions of 10-3 and10-2 by System A and B respectively. Urine centrifugation increased the analytical sensitivity of the test and proved to be useful for routine diagnostics. The One-Step RT-qPCR is a fast, sensitive and specific method for canine distemper routine diagnosis and research projects that require sensitive and quantitative methodology
Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.During germination the seed reserve carbohydrates are degraded by alpha-amylase activity. The identification of mRNA is a very important tool for definition of alpha-amylase synthesis kinetics. This study aimed to adapt a PT-PCR methodology for a-identification of amylase mRNA in germinating maize seeds. After three days germination of Saracura BRS4154 and CATI AL34 maize cultivars, the total RNA was isolated by the guanidinium thiocyanate-phenol-chloroform extraction method, with some modifications. The cDNA was obtained from the total RNA, using random primers. The alpha-amylase gene PCR amplification was carried out with cDNA, primers (sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC); gelatina; DMSO and 1,25 units of Taq DNA polimerase per reaction and complete with DEPC water. The amplification cycles were 94ºC/4 minutes, 34 cycles of 94ºC /1 minute, 42ºC/1 minute and 72ºC/1,5 minutes, and finally 72ºC/5 minutes. The RT-PCR product visualization in agarose gel eletcrophoresis indicated that this method presented well defined bands of 249 bp for the both the cultivars, without unspecific bands. The RT-PCR is an eficient method for alpha-amylase expression studies during germination and can be used as a tool for quantitative and qualitative research about alpha-amylase sinthesis kinetics