A Birkhoff connection between quantum circuits and linear classical reversible circuits

Birkhoff's theorem tells how any doubly stochastic matrix can be decomposed as a weighted sum of permutation matrices. Similar theorems on unitary matrices reveal a connection between quantum circuits and linear classical reversible circuits. It triggers the question whether a quantum computer can be regarded as a superposition of classical reversible computers

Cut-rose production in response to planting density in two contrasting cultivars

Growing in lower planting density, rose plants produce more assimilates, which can be used to produce more and/or heavier flowering shoots. The effect of planting density was investigated during a period including the first five flowering flushes of a young crop. In a heated greenhouse two cut-rose cultivars were grown under bent canopy management. ‘Akito’ on own-roots and ‘Ilios’ on ‘Natal Briar’ rootstock were planted with densities of 8 and 4 plants per m2. Starting at the end of June 2007, flowering shoots were harvested over a time span of eight months. Based on ‘flowering flushes’, times of high harvest rate, the harvesting time span could be divided into five consecutive periods, each including one flush. The cultivars showed contrasting responses to planting density. In the first three periods the response in ‘Ilios’ was extraordinary, because at low density plants did not produce more flowering shoots, as would be expected. However, the response in shoot fresh weight was larger for ‘Ilios’ than for ‘Akito’, 35% compared to 21% over the entire study period. The results imply that there was a genetic difference in the effect of assimilate availability and/or local light environment. During the first three periods, these factors can not have influenced shoot number in ‘Ilios’, while they did in ‘Akito’. It is suggested that decreases of assimilate availability in winter caused the shoot number response to emerge for ‘Ilios’ later on

Media Discourse about Entrepreneurial Journalism: Implications for Journalistic Capital

Drawing on insights from field theory, this article examines journalists’ textual and discursive construction of entrepreneurial journalism from 2000 to 2014. The goal is to understand how such discursive practices contribute to the articulation and legitimation of entrepreneurial journalism as a form of cultural capital as the field’s economic imperatives change. The findings suggest that "entrepreneurial journalism" is a condensational term: it is defined broadly and loosely but generally in a positive way. Despite the potential for disruption to long-standing journalistic doxa, particularly normative stances related to the separation of editorial and commercial interests, much of the examined discourse seems to reflect a belief that entrepreneurialism is not only acceptable but even vital for survival in a digital age

De lerende regio : kennisarrangementen voor vitale regio's

Publicatie van Netwerk Platteland, in samenwerking met de Groene Kennis Coöperatie en het LEI, in opdracht van het ministerie van LNV. Verhalen van mensen die vanuit verschillende regio's en verschillende rollen betrokken zijn bij het opzetten van een regionaal kennisarrangent. Ter inspiratie voor iedereen die in zijn of haar regi

Time-resolved spectroscopy of the primary photosynthetic processes of membrane-bound reaction centers from an antenna-deficient mutant of Rhodobacter capsulatus

The primary photosynthetic reactions in whole membranes of the antenna-deficient mutant strain U43 (pTXA6–10) of Rhodobacter capsulatus are studied by transient absorption and emission spectroscopy with subpicosecond time resolution. Extensive similarities between the transient absorption data on whole membranes and on isolated reaction centers support the idea that the primary processes in isolated reaction centers are not modified by the isolation procedure

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos