METODE PEMBELAJARAN PADUAN SUARA ONE VOICE SMP NEGERI 1 SURABAYA DALAM RANGKA KARANGTURI INTERNATIONAL CHOIR COMPETITION 2019

Paduan suara One Voice SMP Negeri 1 Surabaya terkenal dengan beberapa prestasinya baik di tingkat nasional maupun internasional. Semenjak Alexander Lassol menjadi pelatih di SMP Negeri 1 Surabaya pada tahun 2015, prestasi One Voice mulai meningkat drastis. Penelitian ini bertujuan untuk menjawab ketiga rumusan masalah yaitu tentang perencanaan latihan One Voice, metode pembelajaran One Voice, serta hasil pembelajaran One Voice. Metode penelitian ini menggunakan pendekatan analisis kualitatif. Objek dari dari penelitian ini ialah metode pembelajaran paduan suara One Voice SMP Negeri 1 Surabaya Dalam Rangka Karangturi International Choir Competition 2019, pengumpulan data di lakukan dengan wawancara, pengamatan, catatan lapangan, dan dokumentasi, serta menggunakan teknik analisis data dengan reduksi data, penyajian data dan penarikan kesimpulan. Pembelajaran dalam rangka Karangturi International Choir competition 2019 ini One Voice memiliki perencanaan latihan yang didalamnya meliputi rencana latihan fisik, latihan vokal, dan latihan pendengaran/menyimak. Alexander Lassol selaku pelatih paduan suara One Voice, menerapkan 3 metode dalam pembelajarannya. Tiga metode yang diterapkan oleh pelatih Alexander Lassol pada pembelajaran paduan suara One Voice SMP Negeri 1 Surabaya adalah metode linear, metode latihan bersama teman, dan Metode drill. Hasil pembelajaran One Voice dalam rangka mengikuti Karangturi Choir Competition 2019 kali ini mengalami penurunan

FLOTAC Technique for Soil-Transmitted Helminth Infection Diagnosis

Human helmintiasis is a neglected disease with significant economic impacts caused by its effects on performance and cognition. The burden of many helminth infections is not well understood due to the lack of progress in detecting low-intensity infection in elimination programs. Furthermore, the decision for individual and community treatments, as well as the community-based control program evaluation, obviously depends on the technics used for parasitological diagnostic. A well-established diagnostic technic will be beneficial to detect and eliminate the disease. Therefore, this study aimed to compare the performance of FLOTAC and FECT technics for detecting helminth infections in human stool. A total of 149 fecal specimens were collected from schoolchildren in Nangapanda village, Ende District, East Nusa Tenggara Province in 2012. The sensitivity of both technics was analyzed using the kappa analysis. Positive results from both technics were used as the gold standard. The sensitivity of FLOTAC for diagnosing T. Trichiura, A. lumbricoides and hookworm infections were 100%, 100%, and 82%, respectively, while the sensitivity of FECT was 80%, 7%, and 18%, respectively. FLOTAC yielded considerably higher mean faecal egg counts (11,452, 1,038, and 19 eggs per gram stool (EPG) for A. lumbricoides, T. Trichiura, and hookworm). FLOTAC technique was considerably more sensitive than FECT in diagnosing soil-transmitted helminth infections. In conclusion, FLOTAC can be used as a diagnosis tool for future helminth control programs

Detection of P30 Gene to Diagnosis of Toxoplasmosis by Using Polymerase Chain Reaction

Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. In healthy persons (immunocompetent) the infection is usually asymptomatic; however in immunocompromised patients, especially AIDS patients, the infection can be fatal. Primary infection in pregnant women can be transmitted to the fetus via the placenta. Therefore laboratory examination is absolutely neccesary to assess the presence of T.gondii infection hence prompt treatment can be given to prevent further damage. The aim of this study is to know whether by using P30 gene as target the Polymerase chain reaction (PCR) can detect T.gondii DNA in Indonesia. The PCR was performed on the DNA which had been isolated against P30 gene as target by using the method described by Weiss et al and Chang & Ho. The P30 gene primers consisted of oligo 1: 5’CACACGGTTGTATGTCGGTTTCGCT3’ and oligo 2: 5’TCAAGGAGCTCAATGTTAC GCT3’. The DNA samples used in the PCR with P30 gene as target were derived from the following materials: (a) pure T.gondii DNA of various concentrations, (b) a mixture of pure T.gondii DNA and normal human blood DNA, (c) tachyzoite DNA derived from the mixture of 99 ml normal human blood and 1 ml tachyzoite suspension with the following amount of tachyzoites :1000,100, 50, 40, 30, 20 and 10 tachyzoites. It was shown that no specific bands were observed in the PCR with P30 gene as target (performed according to the method described by Weiss et al). The PCR according to the method described by Chang & Ho did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed. The results obtained showed that the minimal DNA concentrations which still could be detected using P30 gene as target were as follows : 0.001 ng DNA in 50 ml PCR solution from samples of pure DNA, 0.025 ng DNA in 50 ml PCR solution from samples of pure DNA mixed with normal human blood and the amount of DNA originated from at least 20 tachyzoites. It was concluded that the assay using P30 gene as target could be used for detecting T.gondii DNA in Indonesia

A Longitudinal Study of BCG Vaccination in Early Childhood: The Development of Innate and Adaptive Immune Responses

BCG vaccine drives a strong T helper 1 cellular immunity which is essential for the protection against mycobacteria, however recent studies suggest that BCG vaccination can have non-specific beneficial effects unrelated to tuberculosis. In the present cohort study the development of cytokine profiles following BCG vaccination was investigated. Immune responses to PPD were assessed before vaccination and at ages of 5 months, 1 year, and 2 years, followed by BCG scar measurement at 4 years of age. BCG was shown to induce both Th1 and Th2 type responses against PPD at about 5 months of age after vaccination, and while Th1 response was sustained, Th2 responses declined over time. However, BCG scar size was strongly correlated with Th2 responses to PPD at 5 months of age. Importantly, we observed no clear effects of BCG vaccination on innate immune responses in terms of early IL-10 or TNF-α production whereas some alterations in general adaptive immune responses to PHA were observed

The Prevalence of Lymphatic Filariasis in Elementary School Childre in Endemic Areas : a Baseline Survey Prior to Mass Drug Administration in Pekalongan District – Indonesia

Backgound : WHO initiated lymphatic filariasis (LF) elimination globally. Pekalongan District, as LF endemic area, started a program of mass drug administration (MDA) to combat LF in 2015. This study aimed to determine prevalence of Wucheria Bancroft infection prior to the MDA. Methods : LF infection was detected by the existence of circulating filarial antigen (CFA) W.bancroft using immunochromatographic card test (ICT). The study population consisted of 1404 elementary school (ES) students living in Pekalongan District. Overall, 1033 were selected as study subjects. Prevalence survey was also conducted on 436 general population in areas where infected students were found. Results : The subjects ranged from 7-17 yr old (mean 9.85±1.296) and equally distributed between both sexes. Prevalence of W.bancrofti infection was 1.98% in children. Infection was mostly found in older students (12 yr old), male, in 6th grade, but did not differ significantly different by school (P=0.009) and sub-district (P=0000). Most of children with LF infection were found in Tirto Sub District. In general population, the prevalence of W.bancroft infection in Tirto was 4.4%. Proportion of infection in males (12.2%) was greater than female (3.8%), with 78.9 pf positive cases were in adult over 20yr old. Conclusion : Cases of W. Bancroft infection exist in Pekalongan District, both in children and adults. Implementation of MDA must be carefully monitored in order to achieve elimination target

Impact of six rounds of mass drug administration on brugian filariasis and soil-transmitted helminth infections in Eastern Indonesia

BACKGROUND: The lymphatic filarial parasite Brugia timori occurs only in eastern Indonesia where it causes high morbidity. The absence of an animal reservoir, the inefficient transmission by Anopheles mosquitoes and the high sensitivity to DEC/albendazole treatment make this species a prime candidate for elimination by mass drug administration (MDA). METHODOLOGY/PRINCIPAL FINDINGS: We evaluated the effect of MDA using DEC and albendazole on B. timori and soil transmitted helminths (STH) in a cross-sectional study of a sentinel village on Alor Island annually over a period of 10 years. Pre-MDA the microfilaria (MF) prevalence was 26% and 80% of the residents had filaria-specific IgG4 antibodies. In 2010, 34 months after the 6(th) round of MDA, MF and antibody rates were only 0.17% and 6.4%, respectively. The MDA campaign had also a beneficial effect on STH. Baseline prevalence rates for Ascaris, hookworm and Trichuris were 34%, 28%, and 11%, respectively; these rates were reduced to 27%, 4%, and 2% one year after the 5(th) round of MDA. Unfortunately, STH rates rebounded 34 months after cessation of MDA and approached pre-MDA rates. However, the intensity of STH infection in 2009 was still reduced, and no heavy infections were detected. CONCLUSIONS/SIGNIFICANCE: MDA with DEC/albendazole has had a major impact on B. timori MF and IgG4 antibody rates, providing a proof of principle that elimination is feasible. We also documented the value of annual DEC/albendazole as a mass de-worming intervention and the importance of continuing some form of STH control after cessation of MDA for filariasis

Community rates of IgG4 antibodies to Ascaris haemoglobin reflect changes in community egg loads following mass drug administration

BACKGROUND:Conventional diagnostic methods for human ascariasis are based on the detection of Ascaris lumbricoides eggs in stool samples. However, studies of ascariasis in pigs have shown that the prevalence and the number of eggs detected in the stool do not correlate well with exposure of the herd to the parasite. On the other hand, an ELISA test measuring antibodies to Ascaris suum haemoglobin (AsHb) has been shown to be useful for estimating transmission intensity on pig farms. In this study, we further characterized the AsHb antigen and screened samples from a population-based study conducted in an area that is endemic for Ascaris lumbricoides in Indonesia to assess changes in AsHb antibody rates and levels in humans following mass drug administration (MDA). METHODOLOGY/PRINCIPAL FINDINGS:We developed and evaluated an ELISA to detect human IgG4 antibodies to AsHb. We tested 1066 plasma samples collected at different times from 599 subjects who lived in a village in rural Indonesia that was highly endemic for ascariasis. The community received 6 rounds of MDA for lymphatic filariasis with albendazole plus diethylcarbamazine between 2002 and 2007. While the AsHb antibody assay was not sensitive for detecting all individuals with Ascaris eggs in their stools, the percentage of seropositive individuals decreased rapidly following MDA. Reductions in antibody rates reflected decreased mean egg output per person both at the community level and in different age groups. Two years after the last round of MDA the community egg output and antibody prevalence rate were reduced by 81.6% and 78.9% respectively compared to baseline levels. CONCLUSION/SIGNIFICANCE:IgG4 antibody levels to AsHb appear to reflect recent exposure to Ascaris. The antibody prevalence rate may be a useful indicator for Ascaris transmission intensity in communities that can be used to assess the impact of control measures on the force of transmission

Impact of two rounds of mass drug administration using diethylcarbamazine combined with albendazole on the prevalence of Brugia timori and of intestinal helminths on Alor Island, Indonesia

BACKGROUND: Annual mass drug administration (MDA) using diethylcarbamizine (DEC, 6 mg/kg) combined with albendazole (alb, 400 mg) is recommended by the Global Programme to Eliminate Lymphatic Filariasis (GPELF). This strategy has been shown to be efficient in the of control bancroftian filariasis, but data on brugian filariasis as well as on the positive side effects on intestinal helminths are lacking. METHODS: The effect of one selective treatment and two rounds of MDA using DEC and alb on the prevalence and intensity of Brugia timori infection were studied on Alor island using a cross-sectional and a cohort approach. Before the campaign and ten months after each treatment cycle microfilariae (mf) were assessed by filtration of night blood. Before and ten months after MDA, stool samples were collected and the prevalence of intestinal helminths were determined. RESULTS: In all, the mf-rate dropped from 26.8% before any treatment to 3.8% following the second MDA. Almost all mf-positive, treated individuals showed very low mf densities. The crude prevalence of hookworm dropped from 25.3% to 5.9%. The reduction of prevalence of Ascaris lumbricoides (32.3% to 27.6%) and Trichuris trichiura (9.4% to 8.9%) was less pronounced. Within a cohort of 226 individuals, which was examined annually, the prevalence of A. lumbricoides dropped from 43.8% to 26.5% and of T. trichiura from 12.8% to 6.6%. The results indicate that this MDA approach reduces not only the mf prevalence of B. timori but also the prevalence of hookworm and to a lesser extent also of A. lumbricoides and T. trichiura. CONCLUSION: The MDA using DEC and alb as recommended by GPELF is extremely effective for areas with brugian filariasis. The beneficial effect of MDA on intestinal helminths may strengthen the national programme to eliminate lymphatic filariasis in Indonesia and may set resources free which are otherwise used for deworming campaigns of schoolchildren

Multicentre evaluations of two new rapid IgG4 tests (WB rapid and panLF rapid) for detection of lymphatic filariasis

In the global effort to eliminate lymphatic filariasis (LF), rapid field-applicable tests are useful tools that will allow on-site testing to be performed in remote places and the results to be obtained rapidly. Exclusive reliance on the few existing tests may jeopardize the progress of the LF elimination program, thus the introduction of other rapid tests would be useful to address this issue. Two new rapid immunochromatographic IgG4 cassette tests have been produced, namely WB rapid and panLF rapid, for detection of bancroftian filariasis and all three species of lymphatic filaria respectively. WB rapid was developed using BmSXP recombinant antigen, while PanLF rapid was developed using BmR1 and BmSXP recombinant antigens. A total of 165 WB rapid and 276 panLF rapid tests respectively were evaluated at USM and the rest were couriered to another university in Malaysia (98 WB rapid, 129 panLF rapid) and to universities in Indonesia (56 WB rapid, 62 panLF rapid), Japan (152 of each test) and India (18 of each test) where each of the tests underwent independent evaluations in a blinded manner. The average sensitivities of WB rapid and panLF rapid were found to be 97.6% (94%–100%) and 96.5% (94%–100%) respectively; while their average specificities were both 99.6% (99%–100%). Thus this study demonstrated that both the IgG4 rapid tests were highly sensitive and specific, and would be useful additional tests to facilitate the global drive to eliminate this disease