324 research outputs found

    The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

    Get PDF
    The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos

    Associations of Advanced Glycation End-Products With Cognitive Functions in Individuals With and Without Type 2 Diabetes: The Maastricht Study

    Get PDF
    Context: Advanced glycation end-products (AGEs) are thought to be involved in the pathogenesis of Alzheimer's disease. AGEs are products resulting from nonenzymatic chemical reactions between reduced sugars and proteins, which accumulate during natural aging, and their accumulation is accelerated in hyperglycemic conditions such as type 2 diabetes mellitus. Objective: The objective of the study was to examine associations between AGEs and cognitive functions. Design, Setting, and Participants: This study was performed as part of the Maastricht Study, a population-based cohort study in which, by design, 215 participants (28.1%) had type 2 diabetes mellitus. Main Outcome Measures: We examined associations of skin autofluorescence (SAF) (n = 764), an overall estimate of skin AGEs, and specific plasma protein-bound AGEs (n = 781) with performance on tests for global cognitive functioning, information processing speed, verbal memory (immediate and delayed word recall), and response inhibition. Results: After adjustment for demographics, diabetes, smoking, alcohol, waist circumference, total cholesterol/high-density lipoprotein cholesterol ratio, triglycerides, and lipid-lowering medication use, higher SAF was significantly associated with worse delayed word recall (regression coefficient, b = - 0.44; P = .04), and response inhibition (b = 0.03; P = .04). After further adjustment for systolic blood pressure, cardiovascular disease, estimated glomerular filtration rate, and depression, associations were attenuated (delayed word recall, b = - 0.38, P = .07; response inhibition, b = 0.02, P = .07). Higher pentosidine levels were associated with worse global cognitive functioning (b = - 0.61; P = .04) after full adjustment, but other plasma AGEs were not. Associations did not differ between individuals with and without diabetes. Conclusion: We found inverse associations of SAF (a noninvasive marker for tissue AGEs) with cognitive performance, which were attenuated after adjustment for vascular risk factors and depression

    Exercise SBP response and incident depressive symptoms: The Maastricht Study

    Get PDF
    Objective : An exaggerated exercise SBP, which is potentially modifiable, may be associated with incident depressive symptoms via an increased pulsatile pressure load on the brain. However, the association between exaggerated exercise SBP and incident depressive symptoms is unknown. Therefore, we examined whether exaggerated exercise SBP is associated with a higher risk of depressive symptoms over time. Methods : We used longitudinal data from the population-based Maastricht Study, with only individuals free of depressive symptoms at baseline included (n = 2121; 51.3% men; age 59.5 +/- 8.5 years). Exercise SBP was measured at baseline with a submaximal exercise cycle test. We calculated a composite score of exercise SBP based on four standardized exercise SBP measures: SBP at moderate workload, SBP at peak exercise, SBP change per minute during exercise and SBP 4 min after exercise. Clinically relevant depressive symptoms were determined annually at follow-up and defined as a Patient Health Questionnaire score of at least 10. Results : After a mean follow-up of 3.9 years, 175 participants (8.3%) had incident clinically relevant depressive symptoms. A 1 SD higher exercise SBP composite score was associated with a higher incidence of clinically relevant depressive symptoms [hazard ratio: 1.27 (95% confidence interval: 1.04-1.54)]. Results were adjusted for age, sex, education level, glucose metabolism status, lifestyle, cardiovascular risk factors, resting SBP and cardiorespiratory fitness. Conclusion : A higher exercise SBP response is associated with a higher incidence of clinically relevant depressive symptoms

    A molecular signature of epithelial host defense: comparative gene expression analysis of cultured bronchial epithelial cells and keratinocytes

    Get PDF
    BACKGROUND: Epithelia are barrier-forming tissues that protect the organism against external noxious stimuli. Despite the similarity in function of epithelia, only few common protective mechanisms that are employed by these tissues have been systematically studied. Comparative analysis of genome-wide expression profiles generated by means of Serial Analysis of Gene Expression (SAGE) is a powerful approach to yield further insight into epithelial host defense mechanisms. We performed an extensive comparative analysis of previously published SAGE data sets of two types of epithelial cells, namely bronchial epithelial cells and keratinocytes, in which the response to pro-inflammatory cytokines was assessed. These data sets were used to elucidate a common denominator in epithelial host defense. RESULTS: Bronchial epithelial cells and keratinocytes were found to have a high degree of overlap in gene expression. Using an in silico approach, an epithelial-specific molecular signature of gene expression was identified in bronchial epithelial cells and keratinocytes comprising of family members of keratins, small proline-rich proteins and proteinase inhibitors. Whereas some of the identified genes were known to be involved in inflammation, the majority of the signature represented genes that were previously not associated with host defense. Using polymerase chain reaction, presence of expression of selected tissue-specific genes was validated. CONCLUSION: Our comparative analysis of gene transcription reveals that bronchial epithelial cells and keratinocytes both express a subset of genes that is likely to be essential in epithelial barrier formation in these cell types. The expression of these genes is specific for bronchial epithelial cells and keratinocytes and is not seen in non-epithelial cells. We show that bronchial epithelial cells, similar to keratinocytes, express components that are able to form a cross-linked protein envelope that may contribute to an effective barrier against noxious stimuli and pathogens

    Erythematous nodes, urticarial rash and arthralgias in a large pedigree with NLRC4-related autoinflammatory disease, expansion of the phenotype

    Get PDF
    Autoinflammatory disorders (AID) are a heterogeneous group of diseases, characterized by an unprovoked innate immune response, resulting in recurrent or ongoing systemic inflammation and fever1-3. Inflammasomes are protein complexes with an essential role in pyroptosis and the caspase-1-mediated activation of the proinflammatory cytokines IL-1β, IL-17 and IL-18

    Anomalous Lattice Vibrations of Single and Few-Layer MoS2

    Full text link
    Molybdenum disulfide (MoS2) of single and few-layer thickness was exfoliated on SiO2/Si substrate and characterized by Raman spectroscopy. The number of S-Mo-S layers of the samples was independently determined by contact-mode atomic-force microscopy. Two Raman modes, E12g and A1g, exhibited sensitive thickness dependence, with the frequency of the former decreasing and that of the latter increasing with thickness. The results provide a convenient and reliable means for determining layer thickness with atomic-level precision. The opposite direction of the frequency shifts, which cannot be explained solely by van der Waals interlayer coupling, is attributed to Coulombic interactions and possible stacking-induced changes of the intralayer bonding. This work exemplifies the evolution of structural parameters in layered materials in changing from the 3-dimensional to the 2-dimensional regime.Comment: 14 pages, 4 figure

    Occupational exposure to gases/fumes and mineral dust affect DNA methylation levels of genes regulating expression

    Get PDF
    Many workers are daily exposed to occupational agents like gases/fumes, mineral dust or biological dust, which could induce adverse health effects. Epigenetic mechanisms, such as DNA methylation, have been suggested to play a role. We therefore aimed to identify differentially methylated regions (DMRs) upon occupational exposures in never-smokers and investigated if these DMRs associated with gene expression levels. To determine the effects of occupational exposures independent of smoking, 903 never-smokers of the LifeLines cohort study were included. We performed three genome-wide methylation analyses (Illumina 450 K), one per occupational exposure being gases/fumes, mineral dust and biological dust, using robust linear regression adjusted for appropriate confounders. DMRs were identified using comb-p in Python. Results were validated in the Rotterdam Study (233 never-smokers) and methylation-expression associations were assessed using Biobank-based Integrative Omics Study data (n = 2802). Of the total 21 significant DMRs, 14 DMRs were associated with gases/fumes and 7 with mineral dust. Three of these DMRs were associated with both exposures (RPLP1 and LINC02169 (2x)) and 11 DMRs were located within transcript start sites of gene expression regulating genes. We replicated two DMRs with gases/fumes (VTRNA2-1 and GNAS) and one with mineral dust (CCDC144NL). In addition, nine gases/fumes DMRs and six mineral dust DMRs significantly associated with gene expression levels. Our data suggest that occupational exposures may induce differential methylation of gene expression regulating genes and thereby may induce adverse health effects. Given the millions of workers that are exposed daily to occupational exposures, further studies on this epigenetic mechanism and health outcomes are warranted

    Деякі аспекти діяльності уповноважених Наркомату (Міністерства) заготівель СРСР на Кіровоградщині в 1944-1946 рр. та їх наслідки

    Get PDF
    У статті на основі аналізу архівних документів висвітлена діяльність уповноважених Наркомату (Міністерства) заготівель СРСР на Кіровоградщині у перші післявоєнні роки, вказані наслідки, спричинені цією діяльністю - тотальне зубожіння населення області через вилучення майже всіх продуктів харчування.В статье на основе анализа архивных документов освещена деятельность уполномоченных Наркомата (Министерства) заготовок СССР на Кировоградщине в первые послевоенные годы, указаны последствия, причиненные этой деятельностью - тотальное обнищание населения области посредством изъятия почти всех продуктов питания.The activity of authorized people of the Ministry of Supply of the USSR in Kirovograd region in the first post-war years had been analyzed in the article on the basis of analysis of the archival documents and the consequences caused by this activity like the total impoverishment of population of the region through the confiscation of almost all food stuff had been indicated in this article as well
    corecore