Teste de paternidade em eqinos Mangalarga-Marchador pela técnica do DNA-"fingerprinting"

GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 105-fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.Sondas moleculares de minissatélites CG-ricas isoladas do genoma humano têm apresentado pouca habilidade de individualização em cavalos. Neste trabalho foram isoladas novas seqüências de DNA, que podem ser utilizadas para teste de paternidade em cavalos. DNA genômico de cavalos Mangalarga-Marchador foi tratado com enzimas de restrição que digerem preferencialmente seqüências não-repetitivas, preservando, assim, a estrutura onde os mini e microssatélites estão localizados. Quatro clones (S01, S05, S07 and S09), selecionados a partir de uma livraria genômica com o oligonucleotídeo (TG)n, demonstraram um perfil de hibridização semelhante com bandas do tipo DNA "fingerprinting". Utilizando estas sondas, o poder de individualização obtido foi de 10-8, 105 vezes mais elevado do que o obtido com a M13, outra sonda do tipo GC-rica. Todos os clones foram eficientes para a determinação do parentesco em cruzamentos e apresentaram uma seqüência-consensus de 27 pb, GTTTCATTTATTATTCTTTGGAAGAAA, que estava repetida 12, 18, 11 e 21 vezes nos clones S01, S05, S07 e S09, respectivamente

Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

Sondas moleculares de minissatélites CG-ricas isoladas do genoma humano têm apresentado pouca habilidade de individualização em cavalos. Neste trabalho foram isoladas novas seqüências de DNA, que podem ser utilizadas para teste de paternidade em cavalos. DNA genômico de cavalos Mangalarga-Marchador foi tratado com enzimas de restrição que digerem preferencialmente seqüências não-repetitivas, preservando, assim, a estrutura onde os mini e microssatélites estão localizados. Quatro clones (S01, S05, S07 and S09), selecionados a partir de uma livraria genômica com o oligonucleotídeo (TG)n, demonstraram um perfil de hibridização semelhante com bandas do tipo DNA "fingerprinting". Utilizando estas sondas, o poder de individualização obtido foi de 10-8, 105 vezes mais elevado do que o obtido com a M13, outra sonda do tipo GC-rica. Todos os clones foram eficientes para a determinação do parentesco em cruzamentos e apresentaram uma seqüência-consensus de 27 pb, GTTTCATTTATTATTCTTTGGAAGAAA, que estava repetida 12, 18, 11 e 21 vezes nos clones S01, S05, S07 e S09, respectivamente.GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09) selected from a genomic library screened with a (TG)n oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 105-fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively

New vectors derived from pUC18 for cloning and thermal-induced expression in Escherichia coli

We report the construction of two vectors for Escherichia coli: pUC72, for molecular cloning, and pPLT7, for thermal-induced expression. The main feature of pUC72 is a novel polylinker region that includes restriction sites for Nde I and Nco I which provide an ATG codon for proper translation initiation of expressed genes. Vector pPLT7 is ideal for thermo-inducible expression in host cells that carry the cI857 repressor gene. The use of pPLT7 was validated by the successful expression of the genes encoding carp and porcine growth hormones. These vectors provide novel cloning possibilities in addition to simple, non-expensive, high level expression of recombinant proteins in E. coli

Analysis of Chromobacterium sp. natural isolates from different Brazilian ecosystems

<p>Abstract</p> <p>Background</p> <p><it>Chromobacterium violaceum </it>is a free-living bacterium able to survive under diverse environmental conditions. In this study we evaluate the genetic and physiological diversity of <it>Chromobacterium </it>sp. isolates from three Brazilian ecosystems: Brazilian Savannah (Cerrado), Atlantic Rain Forest and Amazon Rain Forest. We have analyzed the diversity with molecular approaches (16S rRNA gene sequences and amplified ribosomal DNA restriction analysis) and phenotypic surveys of antibiotic resistance and biochemistry profiles.</p> <p>Results</p> <p>In general, the clusters based on physiological profiles included isolates from two or more geographical locations indicating that they are not restricted to a single ecosystem. The isolates from Brazilian Savannah presented greater physiologic diversity and their biochemical profile was the most variable of all groupings. The isolates recovered from Amazon and Atlantic Rain Forests presented the most similar biochemical characteristics to the <it>Chromobacterium violaceum </it>ATCC 12472 strain. Clusters based on biochemical profiles were congruent with clusters obtained by the 16S rRNA gene tree. According to the phylogenetic analyses, isolates from the Amazon Rain Forest and Savannah displayed a closer relationship to the <it>Chromobacterium violaceum </it>ATCC 12472. Furthermore, 16S rRNA gene tree revealed a good correlation between phylogenetic clustering and geographic origin.</p> <p>Conclusion</p> <p>The physiological analyses clearly demonstrate the high biochemical versatility found in the <it>C. violaceum </it>genome and molecular methods allowed to detect the intra and inter-population diversity of isolates from three Brazilian ecosystems.</p

Isolation and Characterization of Yeasts Able to Assimilate Sugarcane Bagasse Hemicellulosic Hydrolysate and Produce Xylitol Associated with Veturius transversus

Yeasts are an important component of insect gut microbial content, playing roles such as degradation of polymers and toxic compounds, biological control, and hormone, vitamin, and digestive enzyme production. The xylophagous beetle gut is a hyperdiverse habitat and a potential source of new species with industrial abilities such as enzyme production, pentose fermentation, and biodetoxification. In this work, samples of Veturius transversus (Passalidae, Coleoptera, and Insecta) were collected from the Central Amazon Rainforest. Their guts were dissected and a total of 20 microbial colonies were isolated using sugarcane bagasse hemicellulosic hydrolysate. They were identified as having 10 distinct biochemical profiles, and genetic analysis allowed identification as three clades in the genera Candida, Williopsis, and Geotrichum. All colonies were able to assimilate D-xylose and 18 were able to produce xylitol, especially a strain of Geotrichum, with a maximum yield of 0.502 g·g−1. These results agree with a previous prediction that the microbial community associated with xylophagous insects is a promising source of species of biotechnological interest

Discrimination of Pejibaye (Bactris gasipaes) landraces in Brazilian Amazonia using molecular markers (RAPDs)

The pejibaye (Bactris gasipaes Kunth, Palmae) was domesticated for it fruits by the first peoples of western Amazonia. Consequently it exhibits a landrace complex that has been partially characterized morphologically and mapped. Along the Amazonas and Solimões Rivers, in Brazil, three landraces have been proposed [Pará (Amazonas River), Solimões (lower and middle Solimões River), Putumayo (upper Solimões River)], with indications that the Solimões landrace could be an artifact of the morphometric analysis. RAPD markers were used to evaluate the three landrace hypothesis. DNA was extracted from 30 plants of each landrace maintained in the Pejibaye germplasm bank, Manaus, AM, Brazil. During PCR amplification, 8 primers generated 80 markers, Jaccard similarities were estimated, the plants were grouped with UPGMA. The dendrogram contained 2 large groups that joined at a similarity of 0.535: the group of the Pará landrace contained 26 plants of this race, 5 of the Putumayo and 1 of the Solimões; the group of the Solimões River contained 29 plants of the Solimões race, 19 of the Putumayo and 1 of the Pará. The structure of the second group suggested that there is only one landrace along the Solimões River, since the plants were mixed in sub-groups without apparent order. This marker-based genetic analysis did not support the three landrace hypothesis and suggests that the Putumayo landrace extends along the Solimões River to central Amazonia. Genetic and morphological data must now be used to evaluate this new hypothesis.A pupunha (Bactris gasipaes Kunth, Palmae) foi domesticada por seu fruto pelos primeiros povos da Amazônia Ocidental, possuindo um complexo de raças primitivas (landraces) parcialmente caracterizado e mapeado morfologicamente. Ao longo dos Rios Amazonas e Solimões, no Brasil, foram propostas três raças primitivas [Pará (Rio Amazonas), Solimões (baixo e médio Rio Solimões), Putumayo (alto Rio Solimões)], com indicações de que a raça Solimões poderia ser artefato de análise morfométrica. Marcadores RAPDs foram usados para avaliar a hipótese de três raças. Extraiu-se DNA de 30 plantas de cada raça mantida no BAG de Pupunha em Manaus, AM, Brasil. Na amplificação por PCR, 8 primers geraram 80 marcadores, cujas similaridades de Jaccard foram estimadas para agrupamento das plantas com UPGMA. O dendrograma conteve 2 grandes grupos que juntaram-se a uma similaridade de 0,535o grupo da raça Pará conteve 26 plantas dessa raça, 5 da Putumayo e 1 da Solimões; o grupo do Rio Solimões conteve 29 plantas da raça Solimões, 19 da Putumayo e 1 da Pará. A estrutura do segundo grupo sugere que existe apenas uma raça ao longo do Rio Solimões, pois as plantas amostradas são misturadas em sub-grupos sem ordem aparente. A análise genética não apoia a hipótese de três raças e sugere que a raça Putumayo estende-se ao longo do Rio Solimões até Amazônia central. Será necessário juntar dados genéticos com morfológicos para avaliar esta nova hipótese com mais precisão

Genetic variability in natural populations of Zeyheria montana mart. from the Brazilian Cerrado

Zeyheria montana, an endemic species of the Bignoniaceae family from the Brazilian Cerrado's known for its anti-cancer properties, is widely used as imuno stimulant in the popular medicine and its therapeutic activity must be validated by scientific data. The objective of this work was to evaluate the genetic variability of eight plant populations collected within the state of São Paulo, Brazil, via Random Amplification of Polymorphic DNA (RAPD) used as molecular markers. After an optimized protocol for the amplification reaction, nine selected primers generated 105 reproducible bands, indicating up to 60% polymorphism. Analysis of molecular variance (AMOVA) revealed higher genetic variation within populations (84.03%) than among populations (15.97%). The variation values estimated by phiST (0.160) indicated moderate to high inter population structuration. Levels of similarity inter plants with genetic and geographical distances, estimated by the unweighted pair-group method analysis (UPGMA) clustering and non-metric multidimensional scaling (NMDS) ordination methods and by the Mantel test (-0.2345 p = 0.118) denoted that the structure found follows the island model, which assumes that a single population of infinite size may have initiated the existing populations of Zeyheria montana, with no spatial position correlation. Based on the obtained data, a germplasm bank from individuals representing the species variability was established. Furthermore the information here reported can be of importance to develop strategies for the conservation of Z. montana.Zeyheria montana, planta arbustiva da família Bignoniaceae, é uma espécie endêmica do Cerrado e possui atividade anti-câncer, sendo utilizada como estimulante na medicina popular. O objetivo deste estudo foi avaliar a variabilidade genética de oito populações localizadas no estado de São Paulo, utilizando marcadores moleculares de Polimorfismo de DNA Amplificado ao Acaso (RAPD). Após a otimização da reação de amplificação, nove iniciadores selecionados geraram 105 fragmentos RAPD reprodutíveis, sendo que a maioria (60,0%) foi polimórfica. A análise molecular de variância (AMOVA) mostrou que a variabilidade dentro de populações (84,03%) foi maior que entre populações (15,97%). As estimativas de variação fiST (0,1597) indicam estruturação populacional moderadamente alta. O agrupamento por meio de UPGMA, a ordenação pelo NMDS e o teste de Mantel entre as matrizes de distâncias genéticas e geográficas demonstraram que a estruturação encontrada segue um modelo de "ilhas", onde uma única população de tamanho infinito pode ter dado origem às populações atuais de Zeyheria, sem relação com sua posição espacial. Com base nos resultados obtidos foi estruturado um banco de germoplasma de indivíduos, representando a variabilidade da espécie. Adicionalmente, as informações deste estudo são importantes para dar suporte a estratégias de conservação de Z. montana

Cultivation of Trichosporon mycotoxinivorans in sugarcane bagasse hemicellulosic hydrolyzate

Background: The yeast strain IB09 was isolated from the gut of Calosoma sp. (Carabidae, Coleoptera, Insecta) that were collected in the central Amazon rainforest. First, tolerance of the strain to ethanol and heat was tested. Then, IB09 was cultivated in a medium using sugarcane bagasse hemicellulosic hydrolyzate as a carbon source, and cell growth (OD600), specific growth rate (\u3bcMAX, h-1), biomass yield (YB, g.g-1) and relative sugar consumption (RSC, %) were evaluated. Taxonomic identification was determined by sequencing the ITS1 region of IB09 and comparing it to sequences obtained from the GenBank database (NCBI). Results: IB09 showed both ethanol tolerance and thermotolerance. Relative sugar consumption indicated that IB09 was able to perform saccharification of sugarcane bagasse hemicellulosic hydrolyzate, increasing the total reducing sugar concentration by approximately 50%. The \u3bcMAX value obtained was 0,20, indicating that cell growth was slow under the assessed conditions. Biomass yield was 0,701 g per g of consumed sugar, which is relatively high when compared with other findings in the literature. After 120 hrs of cultivation, 80,1% of total reducing sugar had been consumed. Sequencing of the ITS1 region identified IB09 as Trichosporon mycotoxinivorans . Conclusion: This is the first report to document this species in the central Amazon rainforest at this host. Trichosporon mycotoxinivorans has great biotechnological potential for use in the saccharification of sugarcane bagasse hemicellulosic hydrolyzate and for biomass production with this substrate as carbon source

Production of thermostable β-glucosidase and CMCase by Penicillium sp. LMI01 isolated from the Amazon region

Background: Cellulolytic enzymes of microbial origin have great industrial importance because of their wide application in various industrial sectors. Fungi are considered the most efficient producers of these enzymes. Bioprospecting survey to identify fungal sources of biomass-hydrolyzing enzymes from a high-diversity environment is an important approach to discover interesting strains for bioprocess uses. In this study, we evaluated the production of endoglucanase (CMCase) and β-glucosidase, enzymes from the lignocellulolytic complex, produced by a native fungus. Penicillium sp. LMI01 was isolated from decaying plant material in the Amazon region, and its performance was compared with that of the standard isolate Trichoderma reesei QM9414 under submerged fermentation conditions. Results: The effectiveness of LMI01 was similar to that of QM9414 in volumetric enzyme activity (U/mL); however, the specific enzyme activity (U/mg) of the former was higher, corresponding to 24.170 U/mg of CMCase and 1.345 U/mg of β-glucosidase. The enzymes produced by LMI01 had the following physicochemical properties: CMCase activity was optimal at pH 4.2 and the β-glucosidase activity was optimal at pH 6.0. Both CMCase and β-glucosidase had an optimum temperature at 60°C and were thermostable between 50 and 60°C. The electrophoretic profile of the proteins secreted by LMI01 indicated that this isolate produced at least two enzymes with CMCase activity, with approximate molecular masses of 50 and 35 kDa, and β-glucosidases with molecular masses between 70 and 100 kDa. Conclusions: The effectiveness and characteristics of these enzymes indicate that LMI01 can be an alternative for the hydrolysis of lignocellulosic materials and should be tested in commercial formulations