Dynamics and control of the satellite power system

An investigation of the dynamics and control problems specifically related to the Satellite Power System (SPS), to assess performance of selected control concepts, and to identify and initiate development of advanced control technology that would enhance feasibility and performance of the SPS system was made. The initial stages of the study are reported

Automated Particle Identification through Regression Analysis of Size, Shape and Colour

Rapid point of care diagnostic tests and tests to provide therapeutic information are now available for a range of specific conditions from the measurement of blood glucose levels for diabetes to card agglutination tests for parasitic infections. Due to a lack of specificity these test are often then backed up by more conventional lab based diagnostic methods for example a card agglutination test may be carried out for a suspected parasitic infection in the field and if positive a blood sample can then be sent to a lab for confirmation. The eventual diagnosis is often achieved by microscopic examination of the sample. In this paper we propose a computerized vision system for aiding in the diagnostic process; this system used a novel particle recognition algorithm to improve specificity and speed during the diagnostic process. We will show the detection and classification of different types of cells in a diluted blood sample using regression analysis of their size, shape and colour. The first step is to define the objects to be tracked by a Gaussian Mixture Model for background subtraction and binary opening and closing for noise suppression. After subtracting the objects of interest from the background the next challenge is to predict if a given object belongs to a certain category or not. This is a classification problem, and the output of the algorithm is a Boolean value (true/false). As such the computer program should be able to ”predict” with reasonable level of confidence if a given particle belongs to the kind we are looking for or not. We show the use of a binary logistic regression analysis with three continuous predictors: size, shape and color histogram. The results suggest this variables could be very useful in a logistic regression equation as they proved to have a relatively high predictive value on their own

Environmental Injustice\u27s Impact on Asthma Disparities in NYC

Understanding the social determinants of health is essential when looking at low-income minorities in urban cities. Social determinants of health are conditions in the environment in which people are born, which affects a wide range of health and quality-of-life outcomes. Amongst other determinants, adequate housing can have a significant influence on population health outcomes such as asthma. Zoning inequality negatively and disproportionately impacts the health and the overall quality of life of low-income minorities; zoning is correlated to environmental injustice fueling adverse health effects and health disparities among low-income minority populations. Without the opportunity to receive adequate and affordable housing, communities of color will continue to be burdened by zoning regulations and strained by the environmental injustices–leading them to put their health at risk in hazardous areas. This paper seeks to review the state of the literature on the impact of zoning on environmental injustice, social determinants of health, exposure to indoor and outdoor pollutants and outcomes for asthma, with particular emphasis on how hypersegregation exposes people of color to environmental injustice in urban areas. The literature review shows that differences in neighborhood racial demographics and income result in more exposure to environmental injustice and asthma outcomes in New York City. Under representation and under-maintained public housing in black communities has also been associated with disparities in health outcomes

The asymmetric profile of the H76 alpha line emission from MWC349

MWC349 is an emission-line star found by Merrill, Humason and Burwell (1932). Braes, Habing and Schoenmaker (1972) discovered that it is a strong radio source. The radio emission originates in a massive ionized wind that is expanding with a velocity of about 50 km s(-1). Its continuum spectrum fits well a nu(0.6) power law from the cm wavelengths to the far-IR. Radio recombination line emission from the envelope of MWC349 was first detected by Altenhoff, Strittmatter and Wendker (1981). We have obtained good signal-to-noise ratio, Very Large Array observations of the H76 alpha radio recombination line from the ionized wind of MWC349. Our data reveal that the profile is markedly asymmetric, with a steep rise on the blue side. This asymmetry could be due to non-LTE effects in the formation and transfer of the line or to intrinsic asymmetries in the envelope. Our analysis suggests that most probably the peculiar profile is caused by a non-LTE enhancement of the line emission from the side of the envelope nearer to the observer. This asymmetry has the opposite sense than that observed in optical and IR recombination lines, where a different effect (absorption of the stellar continuum by the gas in the wind between the star and the observer) is known to be dominant, leading to the classic P Cygni profile. We propose that the profiles of the radio recombination lines from ionized stellar winds will have this characteristic shape, while optical and IR recombination lines are characterized by P Cygni-like profiles. Unfortunately, at present the detection of radio recombination lines from ionized stellar winds is only feasible for MWC349 and a few other objects

The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein

Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Publisher PDFPeer reviewe

Genesis Concentrator Target Particle Contamination Mapping and Material Identification

The majority of surface particles were found to be < 5 microns in diameter with increasing numbers close to the optical resolution limit of 0.3 microns. Acceleration grid EDS results show that the majority of materials appear to be from the SRC shell and SLA materials which include carbon-carbon fibers and Si-rich microspheres in a possible silicone binder. Other major debris material from the SRC included white paint, kapton, collector array fragments, and Al. Image analysis also revealed that SRC materials were also found mixed with the Utah mud and salt deposits. The EDS analysis of the acceleration grid showed that particles < 1 m where generally carbon based particles. Chemical cleaning techniques with Xylene and HF in an ultrasonic bath are currently being investigated for removal of small particles by the Genesis science team as well as ultra-pure water megasonic cleaning by the JSC team [4]. Removal of organic contamination from target materials is also being investigated by the science team with the use of UV-ozone cleaning devices at JSC and Open University [5]. In preparation for solar wind oxygen analyses at UCLA and Open University [1, 2], surface particle contamination on three Genesis concentrator targets was closely examined to evaluate cleaning strategies. Two silicon carbide (Genesis sample # 60001 and 60003) and one chemical vapor deposited (CVD) 13C concentrator target (60002) were imaged and mosaic mapped with optical microscopes. The resulting full target mosaic images and particle feature maps were subsequently compared with non-flight, but flight-like, concentrator targets and sample return capsule (SRC) materials. Contamination found on the flown concentrator acceleration grid was further examined using a scanning electron microscope (SEM). Energy dispersive X-ray spectroscopy (EDS) for particle identification was subsequently compared with the optical images from the flown targets. Figure 1 show that all three targets imaged in this report are fully intact and do not show any signs of material fractures. However, previous ellipsometry results and overview imaging of both flown SiC targets show a solar wind irradiation gradient from the center focal point to the outer edge [3]. In addition, due to the hard landing, each target has experienced varying degrees of impacts, scratches, and particle debris from the spacecraft and Utah impact site

Stereomicroscope Inspection of Polished Aluminum Collector 50684.0

The Genesis polished aluminum "kidney" collector was damaged during the hard landing of the capsule on September 8, 2004 in the Utah desert. The kidney was introduced into the Genesis (ISO class 4) cleanroom laboratory on November 4, 2004 and stored under nitrogen cover gas. The collector is currently fastened to a highly polished stainless steel plate for secure handling. Curatorial work at JSC has made successful subdivision and subsequent allocation of samples from the kidney

Higher Magnification Imaging of the Polished Aluminum Collector Returned from the Genesis Mission

The polished aluminum collector (previously referred to as the polished aluminum kidney) was intended for noble gas analysis for the Gene-sis mission. The aluminum collector, fabricated from alloy 6061T, was polished for flight with alumina, then diamond paste. Final cleaning was performed by soak-ing and rinsing with hexane, then isopropanol, and last-ly megasonically energized ultrapure water prior to installation. It was mounted inside the collector canister on the thermal shield at JSC in 2000. The polished aluminum collector was not surveyed microscopically prior to flight

Discovery of a Probiotic to Reduce the Risk of Lactic Acidosis in Cattle

Experiments described here were designed to find a way to reduce the productivity loss that is associated with rumen acidosis. A strain of Prevotella bryantii was selected and isolated based on its ability to grow rapidly on starch and to produce organic acids other than lactic acid. Tests with this strain in vitro and in goats and dairy cows support the concept that this bacterium is able to compete for substrate with lactic acid bacteria and that it has promise as a probiotic inoculant to protect ruminants from lactic acidosis

Preliminary Quantification of Image Color Gradient on Genesis Concentrator Silicon Carbine Target 60001

The Genesis spacecraft concentrator was a device to focus solar wind ions onto a 6-cm diameter target area, thus concentrating the solar wind by 20X [1]. The target area was comprised of 4 quadrants held in place by a gold-coated stainless steel "cross" (Fig. 1). To date, two SiC and one chemical vapor deposited (CVD) quadrants have been imaged at 5X using a Leica DM-6000M in autoscan mode. Complete imaging of SiC sample 60001 required 1036 images. The mosaic of images is shown in Fig. 2 and position of analyzed areas in Fig. 3. This mosaic imaging is part of the curatorial documentation of surface condition and mapping of contamination. Higher magnification (50X) images of selected areas of the target and individual contaminant particles are compiled into reports which may be requested from the Genesis Curator [2]