The importance of strategic financial leadership in the UK public sector in a time of financial austerity

Given the severity of financial pressures on public authorities, this report is concerned with how finance managers in public services are coping with the demands placed on them and how they can demonstrate improved value by providing more effective strategic financial leadership. It considers how they are applying managerial approaches and solutions to the challenges of austerity and the role that the public sector finance function can play in this process

Development of a novel PCR based analytical protocol for the characterization of the two variants of prolactin gene that affect milk yield in sheep breeds

Prolactin is a lactogenic hormone which plays a significant role in milk production in mammals, and its depletion in sheep provokes severe reduction of milk secretion. Two different variants within intron 2 of the prolactin gene have been described (A and B) and this polymorphism has been recently proposed as a marker for future breeding schemes in dairy sheep. The present study fully characterized this polymorphism, resulting in a simpler and cost effective PCR-based assay for genetic identification in sheep populations. Up to now, the two variants A and B were identified by their difference in RFLP digestion patterns. This assay, however, is laborious since it requires the generation of a 2.5kb PCR fragment from genomic DNA prior to digestion, which is often difficult to obtain. By sequencing PCR products form AA and BB homozygous animals and performing alignments, we confirmed that the B variant results from a 23bp deletion (sequence: GGTGTTTCTCTTCATAAAGACTC) of the A variant of the prolactin gene. This finding assisted the design of new primers for the identification of prolactin polymorphism based on the size of the PCR product and relinquishes the need of RFLP digestions. Using these developments, we genotyped an experimental flock of 380 Chios breed sheep and carried out association studies. In contrast to other sheep breeds, such as the East Friesian and the Serra da Estela, our preliminary data showed no significant effect of this gene on Chios first lactation milk yield. However, the effects of the prolactin gene merit more investigation

Validation of the 8-item Attitudes Towards Gambling Scale (ATGS-8) in a British population survey

Introduction. Public opinions concerning gambling are an important factor in shaping public policy. Little empirical attention has been given to assessing gambling attitudes within the general population. The aim of the present study is to validate the 8-item Attitudes Towards Gambling Scale (ATGS-8) in British individuals and to investigate associations of these attitudes with frequency of gambling and gambling problems. Methods. Data were derived from 7746 individuals participating in the British Gambling Prevalence Survey 2010, a comprehensive interview-based survey conducted in Great Britain between November 2009 and May 2010. Confirmatory factor analysis and separate regression analyses were applied. Results. The one-dimensional structure of the ATGS-8 was confirmed in the community sample and by gender. Furthermore, more positive attitudes towards gambling were positively related to frequency of gambling and gambling problems. Conclusions. The present study extends the previous evaluations of the scale by providing detailed evidence for the utility and usefulness of the ATGS-8 in a community sample and across gender. The ATGS-8 is a valid instrument to assess public opinion on gambling among the general population

Implications of the variation in biological 18 O natural abundance in body water to inform use of Bayesian methods for modelling total energy expenditure when using doubly labelled water.

RATIONALE: Variation in 18 O natural abundance can lead to errors in the calculation of total energy expenditure (TEE) when using the doubly labelled water (DLW) method. The use of Bayesian statistics allows a distribution to be assigned to 18 O natural abundance, thus allowing a best-fit value to be used in the calculation. The aim of this study was to calculate within-subject variation in 18 O natural abundance and apply this to our original working model for TEE calculation. METHODS: Urine samples from a cohort of 99 women, dosed with 50 g of 20% 2 H2 O, undertaking a 14-day breast milk intake protocol, were analysed for 18 O. The within-subject variance was calculated and applied to a Bayesian model for the calculation of TEE in a separate cohort of 36 women. This cohort of 36 women had taken part in a DLW study and had been dosed with 80 mg/kg body weight 2 H2 O and 150 mg/kg body weight H2 18 O. RESULTS: The average change in the δ18 O value from the 99 women was 1.14‰ (0.77) [0.99, 1.29], with the average within-subject 18 O natural abundance variance being 0.13‰2 (0.25) [0.08, 0.18]. There were no significant differences in TEE (9745 (1414), 9804 (1460) and 9789 (1455) kJ/day, non-Bayesian, Bluck Bayesian and modified Bayesian models, respectively) between methods. CONCLUSIONS: Our findings demonstrate that using a reduced natural variation in 18 O as calculated from a population does not impact significantly on the calculation of TEE in our model. It may therefore be more conservative to allow a larger variance to account for individual extremes

Problem gambling: a suitable case for social work?

Problem gambling attracts little attention from health and social care agencies in the UK. Prevalence surveys suggest that 0.6% of the population are problem gamblers and it is suggested that for each of these individuals, 10–17 other people, including children and other family members, are affected. Problem gambling is linked to many individual and social problems including: depression, suicide, significant debt, bankruptcy, family conflict, domestic violence, neglect and maltreatment of children and offending. This makes the issue central to social work territory. Yet, the training of social workers in the UK has consistently neglected issues of addictive behaviour. Whilst some attention has been paid in recent years to substance abuse issues, there has remained a silence in relation to gambling problems. Social workers provide more help for problems relating to addictions than other helping professions. There is good evidence that treatment, and early intervention for gambling problems, including psycho-social and public health approaches, can be very effective. This paper argues that problem gambling should be moved onto the radar of the social work profession, via inclusion on qualifying and post-qualifying training programmes and via research and dissemination of good practice via institutions such as the Social Care Institute for Excellence (SCIE). Keywords: problem gambling; addictive behaviour; socia

Ageing Contributes to Phenotype Transition in a Mouse Model of Periodic Paralysis

Background: Periodic paralysis (PP) is a rare genetic disorder in which ion channel mutation causes episodic paralysis in association with hyper- or hypokalaemia. An unexplained but consistent feature of PP is that a phenotype transition occurs around the age of 40, in which the severity of potassium-induced muscle weakness declines but onset of fixed, progressive weakness is reported. This phenotype transition coincides with the age at which muscle mass and optimal motor function start to decline in healthy individuals. We sought to determine if the phenotype transition in PP is linked to the normal ageing phenotype transition and to explore the mechanisms involved. Methods: A mouse model of hyperkalaemic PP was compared with wild-type littermates across a range of ages (13–104 weeks). Only male mice were used as penetrance is incomplete in females. We adapted the muscle velocity recovery cycle technique from humans to examine murine muscle excitability in vivo. We then examined changes in potassium-induced weakness or caffeine contracture force with age using ex vivo muscle tension testing. Muscles were further characterized by either Western blot, histology or energy charge measurement. For normally distributed data, a student's t-test (± Welch correction) or one- or two-way analysis of variance (ANOVA) was performed to determine significance. For data that were not normally distributed, Welch rank test, Mann Whitney U test or Kruskal–Wallis ANOVA was performed. When an ANOVA was significant (P < 0.05), post hoc Tukey testing was used. Results: Both WT (P = 0.009) and PP (P = 0.007) muscles exhibit increased resistance to potassium-induced weakness with age. Our data suggest that healthy-old muscle develops mechanisms to maintain force despite sarcolemmal depolarization and sodium channel inactivation. In contrast, reduced caffeine contracture force (P = 0.00005), skeletal muscle energy charge (P = 0.004) and structural core pathology (P = 0.005) were specific to Draggen muscle, indicating that they are caused, or at least accelerated by, chronic genetic ion channel dysfunction. Conclusions: The phenotype transition with age is replicated in a mouse model of PP. Intrinsic muscle ageing protects against potassium-induced weakness in HyperPP mice. However, it also appears to accelerate impairment of sarcoplasmic reticulum calcium release, mitochondrial impairment and the development of core-like regions, suggesting acquired RyR1 dysfunction as the potential aetiology. This work provides a first description of mechanisms involved in phenotype transition with age in PP. It also demonstrates how studying phenotype transition with age in monogenic disease can yield novel insights into both disease physiology and the ageing process itself

Beta-delayed-neutron studies of 135,136^{135,136}Sb and 140^{140}I performed with trapped ions

Beta-delayed-neutron ($\beta$n) spectroscopy was performed using the Beta-decay Paul Trap and an array of radiation detectors. The $\beta$n branching ratios and energy spectra for $^{135,136}$Sb and $^{140}$I were obtained by measuring the time of flight of recoil ions emerging from the trapped ion cloud. These nuclei are located at the edge of an isotopic region identified as having $\beta$n branching ratios that impact the r-process abundance pattern around the A~130 peak. For $^{135,136}$Sb and $^{140}$I, $\beta$n branching ratios of 14.6(11)%, 17.6(28)%, and 7.6(28)% were determined, respectively. The $\beta$n energy spectra obtained for $^{135}$Sb and $^{140}$I are compared with results from direct neutron measurements, and the $\beta$n energy spectrum for $^{136}$Sb has been measured for the first time