Potential zoonotic sources of SARS‐CoV‐2 infections

The severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) causing coronavirus disease-2019 (COVID-19) likely has evolutionary origins in other animals than humans based on genetically related viruses existing in rhinolophid bats and pangolins. Similar to other animal coronaviruses, SARS-CoV-2 contains a functional furin cleavage site in its spike protein, which may broaden the SARS-CoV-2 host range and affect pathogenesis. Whether ongoing zoonotic infections are possible in addition to efficient human-to-human transmission remains unclear. In contrast, human-to-animal transmission can occur based on evidence provided from natural and experimental settings. Carnivores, including domestic cats, ferrets and minks, appear to be particularly susceptible to SARS-CoV-2 in contrast to poultry and other animals reared as livestock such as cattle and swine. Epidemiologic evidence supported by genomic sequencing corroborated mink-to-human transmission events in farm settings. Airborne transmission of SARS-CoV-2 between experimentally infected cats additionally substantiates the possibility of cat-to-human transmission. To evaluate the COVID-19 risk represented by domestic and farmed carnivores, experimental assessments should include surveillance and health assessment of domestic and farmed carnivores, characterization of the immune interplay between SARS-CoV-2 and carnivore coronaviruses, determination of the SARS-CoV-2 host range beyond carnivores and identification of human risk groups such as veterinarians and farm workers. Strategies to mitigate the risk of zoonotic SARS-CoV-2 infections may have to be developed in a One Health framework and non-pharmaceutical interventions may have to consider free-roaming animals and the animal farming industry

Perspectives on the Zika outbreak: herd immunity, antibody-dependent enhancement and vaccine

Submitted by Adagilson Silva ([email protected]) on 2017-05-05T18:22:21Z No. of bitstreams: 1 zika17abr25.pdf: 150751 bytes, checksum: 7c2ffa760d310a51900bc0b7bc387677 (MD5)Approved for entry into archive by Adagilson Silva ([email protected]) on 2017-05-05T18:26:57Z (GMT) No. of bitstreams: 1 zika17abr25.pdf: 150751 bytes, checksum: 7c2ffa760d310a51900bc0b7bc387677 (MD5)Made available in DSpace on 2017-05-05T18:26:57Z (GMT). No. of bitstreams: 1 zika17abr25.pdf: 150751 bytes, checksum: 7c2ffa760d310a51900bc0b7bc387677 (MD5) Previous issue date: 2017Fundação Oswaldo Cruz. Centro de Pesquisas Aggeu Magalhães. Departamento de Virologia e Terapia Experimental. Recife, PE, Brazil.Universidade Federal de Pernambuco. Laboratório de Imunopatologia Keizo Asami. Setor de Virologia. Recife, PE, Brazil.Fundação Oswaldo Cruz. Centro de Pesquisas Aggeu Magalhães. Departamento de Virologia e Terapia Experimental. Recife, PE, Brazil.Fundação Oswaldo Cruz. Centro de Pesquisas Aggeu Magalhães. Departamento de Virologia e Terapia Experimental. Recife, PE, Brazil.Fundação Oswaldo Cruz. Centro de Pesquisas Aggeu Magalhães. Departamento de Virologia e Terapia Experimental. Recife, PE, Brazil

ATLANTIC-PRIMATES: a dataset of communities and occurrences of primates in the Atlantic Forests of South America

Primates play an important role in ecosystem functioning and offer critical insights into human evolution, biology, behavior, and emerging infectious diseases. There are 26 primate species in the Atlantic Forests of South America, 19 of them endemic. We compiled a dataset of 5,472 georeferenced locations of 26 native and 1 introduced primate species, as hybrids in the genera Callithrix and Alouatta. The dataset includes 700 primate communities, 8,121 single species occurrences and 714 estimates of primate population sizes, covering most natural forest types of the tropical and subtropical Atlantic Forest of Brazil, Paraguay and Argentina and some other biomes. On average, primate communities of the Atlantic Forest harbor 2 ± 1 species (range = 1–6). However, about 40% of primate communities contain only one species. Alouatta guariba (N = 2,188 records) and Sapajus nigritus (N = 1,127) were the species with the most records. Callicebus barbarabrownae (N = 35), Leontopithecus caissara (N = 38), and Sapajus libidinosus (N = 41) were the species with the least records. Recorded primate densities varied from 0.004 individuals/km 2 (Alouatta guariba at Fragmento do Bugre, Paraná, Brazil) to 400 individuals/km 2 (Alouatta caraya in Santiago, Rio Grande do Sul, Brazil). Our dataset reflects disparity between the numerous primate census conducted in the Atlantic Forest, in contrast to the scarcity of estimates of population sizes and densities. With these data, researchers can develop different macroecological and regional level studies, focusing on communities, populations, species co-occurrence and distribution patterns. Moreover, the data can also be used to assess the consequences of fragmentation, defaunation, and disease outbreaks on different ecological processes, such as trophic cascades, species invasion or extinction, and community dynamics. There are no copyright restrictions. Please cite this Data Paper when the data are used in publications. We also request that researchers and teachers inform us of how they are using the data. © 2018 by the The Authors. Ecology © 2018 The Ecological Society of Americ

Sorologia para o vírus da Pseudoraiva (VPr) e Brucella abortus em carnívoros silvestres mantidos em cativeiro nos estados de Pernambuco e Paraíba

A brucelose é uma doença emergente a sua complexidade devido ao grande número de espécies da bactéria envolvidas e cada uma delas apresenta distintos fatores epidemiológicos, particulares da patogenia de cada espécie. A Doença de Aujezsky apresenta um grande risco potencial de se transformar em uma doença emergente devido à grande variação de hospedeiros e a capacidade dos vírus da família herpesviridae saltar para outras espécies. Objetivou-se com esse estudo realizar a pesquisa de anticorpos anti- Vírus da Pseudoraiva (VPr), e anti-Brucella abortus em carnívoros silvestres neotropicais mantidos em cativeiro nos estados de Pernambuco e Paraíba. Foram utilizadas 42 amostras de soro, provenientes da população de 17 quatis (Nasua nasua), oito guaxinins (Procyon cancrivorus), três raposas (Cerdocyon thous), três raposas-do-campo (Lycalopex vetulus) e dois gatos-do-mato (Leopardus tigrinus), cinco papa-méis (Eira barbara), dois furões (Galictis vittata) e duas lontras (Lontra longicaudis), oriundos das populações do Horto de Dois Irmãos (Recife, PE), Zoológico Municipal Melo Verçosa (Vitória de Santo Antão, PE) e o Parque Zoobotânico Arruda Câmara (João Pessoa, PB). As amostras foram submetidas aos testes de vírusneutralização para a pesquisa de anticorpos anti-VPr e os testes do Antígeno Acidificado Tamponado (AAT) e Fixação do Complemento (FC) para a pesquisa de anticorpos anti B. Abortus. Na prova de soroneutralização, nenhuma amostra testada demonstrou presença de anticorpos anti-VPr. Na pesquisa de anticorpos para B. abortus foram encontrados um total 19 (45,34%) amostras negativas, 23 (54,76%) amostras positivas na prova do AAT e 15 (80,5%) das amostras negativas e 8 (19,5%) amostras positivas no teste de FC. Em relação a Pseudoraiva mais estudos serão necessários incluíndo animais de vida livre e domésticos, para determinar se ocorre ou não a circulação do vírus na região. Esse foi o primeiro relato de anticorpos contra B. abortus nessas espécies. Os resultados aqui apresentados estão longe de incriminar alguma dessas espécies como um reservatório silvestre bem como interferir no programa nacional de controle. No entanto, o desconhecimento dos aspectos epidemiológicos nas populações silvestres é com certeza um obstáculo para avaliar o Programa Nacional de Controle da Brucelose no Brasil.Brucelosis is an emergent disease and its complexity because the large number of bacterial involved species and also each one shows different epidemiological aspects associated to the pathogenesis in each host species. Aujezsky Disease has also a big potential to become an emergent disease as a consequence to the large host range and the ability to the viruses from Herpesviridae family jump to another species. The aim of this study was determine the Brucella abortus and Pseudorabies virus (PrV) prevalence in neotropical captive wild carnivores from three Zoos in the northeast of Brazil. Blood samples were collected from 42 animals, including 17 coatis (Nasua nasua), eight crabeating raccoons (Procyon cancrivorus), three crab-eating foxes (Cerdocyon thous), three hoary foxes (Lycalopex vetulus), two little spotted cats (Leopardus tigrinus), five tayras (Eira barbara), two greater grisons (Galictis vittata) and two neotropical river otters (Lontra longicaudis). To detect B. abortus antibodies, two different serological tests were performed; the Rose-Bengal test (RBT) and the Complement Fixation Test (CFT) and to detect PrV antibodies the virusneutralization was performed. Antibodies to PrV were not detected. Our results showed 19 (45.34%) negative and 23 (54.76%) positive in BBAT test. On CFT 8 (19.50%) were positive and 15 (80.50%). To determine the Pseudorabies epidemiological situation more studies should be necessary in another keep-in-captivity and also in free-range animal populations to well conclude that this virus is not present in these neotropical wild carnivores populations. We are far to incriminate any of these species as wild reservoir and as interfering with national control programs. However, the lack of knowledge of epidemiological aspects in wild populations certainly is an obstruction to evaluate the Brucellosis control program in this country.Conselho Nacional de Pesquisa e Desenvolvimento Científico e Tecnológico - CNP

Human exposure to potential rabies virus transmitters in Olinda, State of Pernambuco, between 2002 and 2006 Exposição humana a potenciais transmissores do vírus rábico em Olinda, Estado de Pernambuco, entre 2002 e 2006

The aim of the present study was to evaluate the data on human exposure to potential rabies virus transmitters in Olinda, State of Pernambuco, Brazil. Data from 7,062 patients who underwent antirabies prophylactic treatment in Olinda between 2002 and 2006 were analyzed. As expected, dogs and cats were involved in most of the cases; i.e. 82.3 and 16.3%, respectively. Attacks by nonhuman primates, bats and other species (unspecified) were also reported. Among the 7,062 patients who underwent antirabies treatment, 582 patients abandoned the treatment, either by indication from the health unit (195) or by their own decision (387). In conclusion, this study has indicated that prophylaxis for human rabies in this urban area will require a multifaceted approach, including health education, post-exposure prophylaxis, systematic vaccination for dogs and cats, and possibly selective control over wild animals such as hematophagous bats.<br>O objetivo deste estudo foi avaliar os dados sobre a exposição humana a potenciais transmissores do vírus rábico em Olinda, Pernambuco, Brasil. Foram analisados dados de 7.062 pacientes submetidos ao tratamento anti-rábico em Olinda entre 2002 e 2006. Como esperado, cães e gatos estiveram envolvidos na maioria dos casos; isto é, 82,3 e 16,3%, respectivamente. Ataques por primatas não-humanos, morcegos e outras espécies (não especificadas) também foram relatadas. Dos 7.062 pacientes submetidos ao tratamento anti-rábico, 582 abandonaram o tratamento, seja por indicação da unidade de saúde (195) ou por decisão própria (387). Concluindo, esse estudo indica que a profilaxia da raiva humana nessa área urbana irá requer uma abordagem multifacetada, incluindo educação em saúde, profilaxia pós-exposição, vacinação sistemática de cães e gatos e, eventualmente, o controle seletivo de animais silvestres, tais como morcegos hematófagos

Hepatite E no Brasil e no mundo: revisão de literatura

Made available in DSpace on 2015-09-21T17:25:27Z (GMT). No. of bitstreams: 2 license.txt: 1914 bytes, checksum: 7d48279ffeed55da8dfe2f8e81f3b81f (MD5) marcelo_pinto_etal_IOC_2013.pdf: 523630 bytes, checksum: 7d68d7c3f3f3c37b8142a26b568ba52c (MD5) Previous issue date: 2013Universidade Federal Rural do Rio de Janeiro. Departamento de Microbiologia e Imunologia Veterinária. Seropédica, RJ, Brasil.Liebig Universität Gießen. Institut für Virologie Justus. Germany.Fundação Oswaldo Cruz. Instituto Oswaldo Cruz. Laboratório de Desenvolvimento Tecnológico em Virologia. Rio de Janeiro, RJ, Brasil.Desde su caracterización en 1983, el virus de la hepatitis E (VHE) ha sido asociado a ocurrencia de brotes ictéricos de hepatitis aguda en regiones endémicas de países como la India y China. Más recientemente, los casos esporádicos de hepatitis E comenzaron a ser descrito y asociados con la transmisión zoonótica de este virus a partir de reservorios animales, principalmente cerdos, cuyos virus fueron caracterizados al final de la década de 90. Así, la hepatitis E es la única Hepatitis viral en que fue evidenciada la transmisión zoonótica. Desde entonces, el descubrimiento de reservorios animales potenciales está contribuyendo cada vez más al cambio del patrón de evolución epidemiológica de la hepatitis E.Since its characterization in 1983, the hepatitis E virus (HEV) has been associated with outbreaks of icteric acute hepatitis in endemic regions such as India. However, sporadic cases of hepatitis E are described as being associated with zoonotic transmission this virus from animal reservoirs, especially pigs, from which viruses were characterized at the end of 1990´s. Since then, the description of potential animal reservoirs is increasingly contributing to the changing epidemiological pattern of Hepatitis E

Perspectives on the Zika outbreak: herd immunity, antibody-dependent enhancement and vaccine

Submitted by Adagilson Silva ([email protected]) on 2017-05-05T18:22:21Z No. of bitstreams: 1 zika17abr25.pdf: 150751 bytes, checksum: 7c2ffa760d310a51900bc0b7bc387677 (MD5)Approved for entry into archive by Adagilson Silva ([email protected]) on 2017-05-05T18:26:57Z (GMT) No. of bitstreams: 1 zika17abr25.pdf: 150751 bytes, checksum: 7c2ffa760d310a51900bc0b7bc387677 (MD5)Made available in DSpace on 2017-05-05T18:26:57Z (GMT). No. of bitstreams: 1 zika17abr25.pdf: 150751 bytes, checksum: 7c2ffa760d310a51900bc0b7bc387677 (MD5) Previous issue date: 2017Fundação Oswaldo Cruz. Centro de Pesquisas Aggeu Magalhães. Departamento de Virologia e Terapia Experimental. Recife, PE, Brazil.Universidade Federal de Pernambuco. Laboratório de Imunopatologia Keizo Asami. Setor de Virologia. Recife, PE, Brazil.Fundação Oswaldo Cruz. Centro de Pesquisas Aggeu Magalhães. Departamento de Virologia e Terapia Experimental. Recife, PE, Brazil.Fundação Oswaldo Cruz. Centro de Pesquisas Aggeu Magalhães. Departamento de Virologia e Terapia Experimental. Recife, PE, Brazil.Fundação Oswaldo Cruz. Centro de Pesquisas Aggeu Magalhães. Departamento de Virologia e Terapia Experimental. Recife, PE, Brazil

Fitness evaluation and molecular characterization of a recombinant murine norovirus (MuNoV) during serial passages in cell culture

Objective: Viral recombination can dramatically change virulence properties of the viruses and has been evidenced in silico for different human NoV strains isolated from clinical cases. Previously, a recombinant Wu20/CW1 strain was obtained after in vitro coinfection of RAW264.7 cells with parental MuNoV strains CW1 and Wu20 (Mathijs et al 2010). The recombinant strain showed reduced plaque size compared to the parental strains and it was suggested that this was due to modified virulence properties in vitro. The aim of this study was to observe and molecularly characterize the natural genetic evolution of the recombinant MuNoV strain across in vitro replications. Methods: MNV strains used in this study were CW1, WU20 (Thackray et al., 2007, kindly provided by prof. H. Virgin) and Rec MNV (Mathijs et al., 2010). RAW 264.7 cells (ATCC TIB-71) grown in Dulbecco’s modified Eagle’s medium (Invitrogen) complemented (DMEMc) with 10 % heat inactivated FCS (BioWhittaker), 2 % penicillin (5000 U /ml) and streptomycin (5000 mg/ml) (PS; Invitrogen) and 1 % HEPES buffer (1 M; Invitrogen). The recombinant strain was serially replicated in vitro in RAW264.7 cells (up to 14 passages). RAW 264.7 (Mouse leukaemic monocyte macrophage) cells were infected with MNV for 72 hours and afterwards lysed by freeze and thaw and viruses purified by ultracentrifugation of both cells and supernatant. Viral plaque sizes of early and late progenies (30 for each virus) were compared with the Image J software. The experiment was repeated two times. RNA was extracted from 140 ml purified suspension 1:5 diluted using the QIAamp Viral RNA Mini KitTM (Qiagen) according to the manufacturer’s instructions. cDNA was generated using a poly-A primer tagged GCCAACGACCGGGAGGCCAGC(T)20 previously described (Müller et al 2007) using superscript ii reverse transcriptase kit (Invitrogen®) treated with RNase H or with other antisense primers using iScript select kit (Bio-Rad®). For the genetic characterization two different studies were conducted. The first study aimed to develop a sequencing strategy in order to obtain the complete genome of the recombinant MNV. Then, in the second study, sequences obtained from different viral passages into RAW cells (e.g. P5 and P14) were compared in order to study the viral adaptation. Primers were designed using the Primer Express® software and netprimer® (Premier biosoft). PCR was performed using taq polymerase with thermopol buffer (new England biolabs) as per manufacturer’s instructions. Afterwards, fragments were excised from agarose gel and DNA purified using the QIAquick Gel Extraction KitTM (Qiagen) and cloning using the PGEM T easy cloning kit (Promega) plasmid DNA was transferred to sequencing by GATC Biotech (Koblenz, Germany). Results: The size of the lysis plaque surface of P2 and P14 showed a considerable divergence. The average plaque size increased from the earlier to the later progenies (from 0.1 mm2 to around 0.5 mm2). A significant difference was demonstrated between them with the Mann and Whitney non parametric statistical test. The genetic characterization of the recombinant strain obtained in vitro was previously based on partial genomic sequences, which provided limited information. Accordingly to our initial molecular analysis of 1.5 kb partial genomic sequence comprising the part of the RdRp and the part of the VP1 did not show any genetic modifications between passage 4 (accession number HM044221) and passage 14 recMNV. Therefore, a strategy for sequencing the complete genome of the different MNV strains was established. The genome of the recombinant MNV was divided into seven regions and the amplification was performed using either new designed or previous published primers. Molecular analysis using the nearly complete genome of the recombinant MNV passage 14 and the two parental strains (CW1 and WU20) showed nine modifications in the genome, comprising three aminoacid changes. Accordingly, two modification were in the RdRp region aa position 1384 Glycine (G) instead of Aspartic acid (D) and aa position 1393 Serine (S) instead of Asparagine (N) and one modification was in the capsid region one modification on aa position 296 Glutamic Acid (E) instead of Lysine. Conclusion: Even preliminary, our data provide evidence of virus adaptation to a new environment (here a cell culture system) after a recombination event. In order to specify whether these hints of genetic mutations could explain fitness modifications during in vitro evolution we need to compare the sequences of passage 14 and the previous viral cellular passages. In addition, two other parameters of in vitro virulence modification will be investigated: (i) virus production and (ii) growth kinetics. The data should provide interesting information about genetic evolution in the genus Norovirus, especially regarding recombination events and explain how a recombinant strain, first disadvantaged compared to its parental strains, could regain fitness by genetic evolution