127 research outputs found
Recommended from our members
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed
Recommended from our members
Previously Identified Genetic Variants in ADGRL3 Are not Associated with Risk for Equine Degenerative Myeloencephalopathy across Breeds.
Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nucleotide polymorphisms (SNPs) in the genomic region, was carried out on 31 postmortem-confirmed eNAD/EDM cases and 43 clinically phenotyped controls from various breeds. No significant association was found between eNAD/EDM confirmed cases and genotype at any of the four identified SNPs (P > 0.05), including the nonsynonymous variant (EquCab2.0 chr3:71,917,591; allelic P = 0.85). These findings suggest that the four SNPs, including the missense variant in the ADGRL3 region, are not associated with risk for eNAD/EDM across multiple breeds of horses
Recommended from our members
Genome-Wide Association Study and Subsequent Exclusion of ATCAY as a Candidate Gene Involved in Equine Neuroaxonal Dystrophy Using Two Animal Models.
Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is an inherited neurodegenerative disorder of unknown etiology. Clinical signs of neurological deficits develop within the first year of life in vitamin E (vitE) deficient horses. A genome-wide association study (GWAS) was carried out using 670,000 SNP markers in 27 case and 42 control Quarter Horses. Two markers, encompassing a 2.5 Mb region on ECA7, were associated with the phenotype (p = 2.05 × 10-7 and 4.72 × 10-6). Within this region, caytaxin (ATCAY) was identified as a candidate gene due to its known role in Cayman Ataxia and ataxic/dystonic phenotypes in mouse models. Whole-genome sequence data in four eNAD/EDM and five unaffected horses identified 199 associated variants within the ECA7 region. MassARRAY® genotyping was performed on these variants within the GWAS population. The three variants within ATCAY were not concordant with the disease phenotype. No difference in expression or alternative splicing was identified using qRT-PCR in brainstem across the ATCAY transcript. Atcayji-hes mice were then used to conduct functional analysis in a second animal model. Histologic lesions were not identified in the central nervous system of Atcayji-hes mice. Additionally, supplementation of homozygous Atcayji-hes mice with 600 IU/day of dl-α-tocopheryl acetate (vitE) during gestation, lactation, and adulthood did not improve the phenotype. ATCAY has therefore been excluded as a candidate gene for eNAD/EDM
Recommended from our members
Single-Cell RNA-seq Reveals Profound Alterations in Mechanosensitive Dorsal Root Ganglion Neurons with Vitamin E Deficiency.
Ninety percent of Americans consume less than the estimated average requirements of dietary vitamin E (vitE). Severe vitE deficiency due to genetic mutations in the tocopherol transfer protein (TTPA) in humans results in ataxia with vitE deficiency (AVED), with proprioceptive deficits and somatosensory degeneration arising from dorsal root ganglia neurons (DRGNs). Single-cell RNA-sequencing of DRGNs was performed in Ttpa-/- mice, an established model of AVED. In stark contrast to expected changes in proprioceptive neurons, Ttpa-/- DRGNs showed marked upregulation of voltage-gated Ca2+ and K+ channels in mechanosensitive, tyrosine-hydroxylase positive (TH+) DRGNs. The ensuing significant conductance changes resulted in reduced excitability in mechanosensitive Ttpa-/- DRGNs. A highly supplemented vitE diet (600 mg dl-α-tocopheryl acetate/kg diet) prevented the cellular and molecular alterations and improved mechanosensation. VitE deficiency profoundly alters the molecular signature and functional properties of mechanosensitive TH+ DRGN, representing an intriguing shift of the prevailing paradigm from proprioception to mechanical sensation
Relief of the Dma1-mediated checkpoint requires Dma1 autoubiquitination and dynamic localization
© 2018 Jones, Chen, et al. Chromosome segregation and cell division are coupled to prevent aneuploidy and cell death. In the fission yeast Schizosaccharomyces pombe, the septation initiation network (SIN) promotes cytokinesis, but upon mitotic checkpoint activation, the SIN is actively inhibited to prevent cytokinesis from occurring before chromosomes have safely segregated. SIN inhibition during the mitotic checkpoint is mediated by the E3 ubiquitin ligase Dma1. Dma1 binds to the CK1-phosphorylated SIN scaffold protein Sid4 at the spindle pole body (SPB), and ubiquitinates it. Sid4 ubiquitination antagonizes the SPB localization of the Polo-like kinase Plo1, the major SIN activator, so that SIN signaling is delayed. How this checkpoint is silenced once spindle defects are resolved has not been clear. Here we establish that Dma1 transiently leaves SPBs during anaphase B due to extensive autoubiquitination. The SIN is required for Dma1 to return to SPBs later in anaphase. Blocking Dma1 removal from SPBs by permanently tethering it to Sid4 prevents SIN activation and cytokinesis. Therefore, controlling Dma1’s SPB dynamics in anaphase is an essential step in S. pombe cell division and the silencing of the Dma1-dependent mitotic checkpoint
FF483-484 motif of human Poleta mediates its interaction with the POLD2 subunit of Poldelta and contributes to DNA damage tolerance
Switching between replicative and translesion synthesis (TLS) DNA polymerases are crucial events for the completion of genomic DNA synthesis when the replication machinery encounters lesions in the DNA template. In eukaryotes, the translesional DNA polymerase eta (Poleta) plays a central role for accurate bypass of cyclobutane pyrimidine dimers, the predominant DNA lesions induced by ultraviolet irradiation. Poleta deficiency is responsible for a variant form of the Xeroderma pigmentosum (XPV) syndrome, characterized by a predisposition to skin cancer. Here, we show that the FF483-484 amino acids in the human Poleta (designated F1 motif) are necessary for the interaction of this TLS polymerase with POLD2, the B subunit of the replicative DNA polymerase delta, both in vitro and in vivo. Mutating this motif impairs Poleta function in the bypass of both an N-2-acetylaminofluorene adduct and a TT-CPD lesion in cellular extracts. By complementing XPV cells with different forms of Poleta, we show that the F1 motif contributes to the progression of DNA synthesis and to the cell survival after UV irradiation. We propose that the integrity of the F1 motif of Poleta, necessary for the Poleta/POLD2 interaction, is required for the establishment of an efficient TLS complex
Homocysteine metabolism pathway is involved in the control of glucose homeostasis: a cystathionine beta synthase deficiency study in mouse
Cystathionine beta synthase (CBS) catalyzes the first step of the transsulfuration pathway from homocysteine to cystathionine, and its deficiency leads to hyperhomocysteinemia (HHcy) in humans and rodents. To date, scarce information is available about the HHcy effect on insulin secretion, and the link between CBS activity and the setting of type 2 diabetes is still unknown. We aimed to decipher the consequences of an inborn defect in CBS on glucose homeostasis in mice. We used a mouse model heterozygous for CBS (CBS+/-) that presented a mild HHcy. Other groups were supplemented with methionine in drinking water to increase the mild to intermediate HHcy, and were submitted to a high-fat diet (HFD). We measured the food intake, body weight gain, body composition, glucose homeostasis, plasma homocysteine level, and CBS activity. We evidenced a defect in the stimulated insulin secretion in CBS+/- mice with mild and intermediate HHcy, while mice with intermediate HHcy under HFD presented an improvement in insulin sensitivity that compensated for the decreased insulin secretion and permitted them to maintain a glucose tolerance similar to the CBS+/+ mice. Islets isolated from CBS+/- mice maintained their ability to respond to the elevated glucose levels, and we showed that a lower parasympathetic tone could, at least in part, be responsible for the insulin secretion defect. Our results emphasize the important role of Hcy metabolic enzymes in insulin secretion and overall glucose homeostasis
Front Behav Neurosci
Cognitive impairment in Down syndrome (DS) has been linked to increased synaptic inhibition. The underlying mechanisms remain unknown, but memory deficits are rescued in DS mouse models by drugs targeting GABA receptors. Similarly, administration of epigallocatechin gallate (EGCG)-containing extracts rescues cognitive phenotypes in Ts65Dn mice, potentially through GABA pathway. Some developmental and cognitive alterations have been traced to increased expression of the serine-threonine kinase DYRK1A on Hsa21. To better understand excitation/inhibition balance in DS, we investigated the consequences of long-term (1-month) treatment with EGCG-containing extracts in adult mBACtgDyrk1a mice that overexpress Dyrk1a. Administration of POL60 rescued components of GABAergic and glutamatergic pathways in cortex and hippocampus but not cerebellum. An intermediate dose (60 mg/kg) of decaffeinated green tea extract (MGTE) acted on components of both GABAergic and glutamatergic pathways and rescued behavioral deficits as demonstrated on the alternating paradigm, but did not rescue protein level of GABA-synthesizing GAD67. These results indicate that excessive synaptic inhibition in people with DS may be attributable, in large part, to increased DYRK1A dosage. Thus, controlling the level of active DYRK1A is a clear issue for DS therapy. This study also defines a panel of synaptic markers for further characterization of DS treatments in murine models
Evidence for a Rad18-Independent Frameshift Mutagenesis Pathway in Human Cell-Free Extracts
Bypass of replication blocks by specialized DNA polymerases is crucial for cell survival but may promote mutagenesis and genome instability. To gain insight into mutagenic sub-pathways that coexist in mammalian cells, we examined N-2-acetylaminofluorene (AAF)-induced frameshift mutagenesis by means of SV40-based shuttle vectors containing a single adduct. We found that in mammalian cells, as previously observed in E. coli, modification of the third guanine of two target sequences, 5'-GGG-3' (3G) and 5'-GGCGCC-3' (NarI site), induces –1 and –2 frameshift mutations, respectively. Using an in vitro assay for translesion synthesis, we investigated the biochemical control of these events. We showed that Pol eta, but neither Pol iota nor Pol zeta, plays a major role in the frameshift bypass of the AAF adduct located in the 3G sequence. By complementing PCNA-depleted extracts with either a wild-type or a non-ubiquitinatable form of PCNA, we found that this Pol eta-mediated pathway requires Rad18 and ubiquitination of PCNA. In contrast, when the AAF adduct is located within the NarI site, TLS is only partially dependent upon Pol eta and Rad18, unravelling the existence of alternative pathways that concurrently bypass this lesion
Consensus-based care recommendations for adults with myotonic dystrophy type 1
Purpose of review
Myotonic dystrophy type 1 (DM1) is a severe, progressive genetic disease that affects between 1 in 3,000 and 8,000 individuals globally. No evidence-based guideline exists to inform the care of these patients, and most do not have access to multidisciplinary care centers staffed by experienced professionals, creating a clinical care deficit.
Recent findings
The Myotonic Dystrophy Foundation (MDF) recruited 66 international clinicians experienced in DM1 patient care to develop consensus-based care recommendations. MDF created a 2-step methodology for the project using elements of the Single Text Procedure and the Nominal Group Technique. The process generated a 4-page Quick Reference Guide and a comprehensive, 55-page document that provides clinical
care recommendations for 19 discrete body systems and/or care considerations.
Summary
The resulting recommendations are intended to help standardize and elevate care for this patient population and reduce variability in clinical trial and study environments. Described as “one of the more variable diseases found in medicine,” myotonic dystrophy type
1 (DM1) is an autosomal dominant, triplet-repeat expansion disorder that affects somewhere between 1:3,000 and 1:8,000 individuals worldwide.1 There is a modest association between increased repeat expansion and disease severity, as evidenced by the average age of onset and overall morbidity of the condition. An expansion of over 35 repeats typically indicates an unstable and expanding mutation. An expansion of 50 repeats or higher is consistent with a diagnosis of DM1. DM1 is a multisystem and heterogeneous disease characterized by distal weakness, atrophy, and myotonia, as well as symptoms in the heart, brain, gastrointestinal tract, endocrine, and respiratory systems. Symptoms may occur at any age. The severity of the condition varies widely among affected individuals, even among members of the same family.
Comprehensive evidence-based guidelines do not currently
exist to guide the treatment of DM1 patients. As a result, the international patient community reports varied levels of care and care quality, and difficulty accessing care adequate to manage their symptoms, unless they have access to multidisciplinary neuromuscular clinics.
Consensus-based care recommendations can help standardize
and improve the quality of care received by DM1 patients
and assist clinicians who may not be familiar with the significant variability, range of symptoms, and severity of the disease. Care recommendations can also improve the landscape for clinical trial success by eliminating some of the inconsistencies in patient care to allow more accurate understanding of the benefit of potential therapies
- …