Abordaje social en el tratamiento de la violencia contra la mujer en atención primaria

La violencia y los malos tratos, han formado parte de la vida cotidiana de las mujeres a lo largo de la historia. Pero esta violencia ha estado "normalizada", por lo que era invisible, no tenía reconocimiento social, y por tanto, estaba silenciada y oculta. En la actuación desde el trabajo social en violencia contra la mujer incluimos todos los tipos de violencia, no solo la violencia física y sexual sino a la violencia psicológica y social, que es más sutil y menos visible, pero no menos perniciosa para la salud y la vida de las mujeres, y más frecuente que la física. La OMS destaca, que es un factor esencial para el deterioro de la salud integral de las mujeres y de sus familias, y consideran que es responsable de uno de cada cinco días de vida perdidos por las mujeres.Existe una interacción importante entre lo social y lo individual; son factores que influyen en la actitud de las personas, y los debemos tener presentes al intervenir con ellas. Podríamos clasificarlos en: Macrosociales: son las creencias y valores culturales, la concepción que tenemos acerca del poder y la obediencia, la legitimación de la violencia... Microsociales: problemas económicos, desempleo,… Psicosociales: actitudes, conductas, conceptos que la persona ha ido adoptando a lo largo de su vida, sobre si misma (baja autoestima), sobre su papel, sus capacidades… Estos factores se intervrelacionan mutuamente, y es necesario entender su influencia en el proceso de socialización, para poder intervenir con las mujeres que viven relaciones de violencia en su pareja y en su familia

Intervención social grupal. Integrando la perspectiva de género (promoción de relaciones saludables y de buen trato)

We have to observe from the different levels of social intervention how the individual, familiar, social and cultural factors are modelling the subject, so that he or she could perceive reality from a determinate place. One privileged place to work on that with women is giving them a group space. Social work with group is a very useful tool. It favours the socialization process and it makes the opinion contrast, reflection and dialogue on one´s own experiences, desires, thoughts, fears and worries easier. It enables you to make contact with internal aspects which are related to conflicts and its problematic. It also prevents the suffering, uneasiness and symptoms chronification.Desde los diferentes niveles de intervención social debemos observar como los factores individuales, familiares, sociales y culturales, van conformando al sujeto para que pueda percibir la realidad desde un lugar determinado. Un lugar privilegiado para intervenir con las mujeres es facilitándoles un espacio grupal. El trabajo social con grupos es una herramienta muy útil. Favorece el proceso de socialización y facilita el contraste de opiniones, la reflexión y el diálogo, sobre las propias vivencias, deseos, pensamientos, miedos e inquietudes. Posibilita tomar contacto con aspectos internos, relacionados con los conflictos, y su problemática. Evita la cronificación de los síntomas, del malestar y del sufrimiento

Structural and functional studies of AT-Rich DNA ligands and their effect on trypanosoma brucei

AT-rich sequences confer unique properties to DNA, such as high polymorphism and flexibility. The abundance of AT-rich DNA in several pathogens' genomes and the ability of specific molecules to selectively target AT base pairs have prompted studies on ligands that interact with the minor groove of high AT content DNA. Of special interest are kinetoplastid parasites, such as Trypanosoma brucei, the causative agent of sleeping sickness, which are distinguished by the presence of a very AT-rich mitochondrial DNA structure called kinetoplast. Minor groove binding ligands have offered critical information on DNA molecular recognition, providing clinically useful strategies against diseases. Thus, the binding affinity and structural characteristics of AT-rich oligonucleotides in complex with different ligands, specifically with HMG proteins and bisimidazolinium compounds, has been chosen as the object of study. The `High Mobility Group¿ (HMG) is a family of architectural proteins that bind to DNA and influence a myriad of essential cellular processes. This research work has focused in two HMG subfamilies: HMGA and HMGB. They bind to the minor groove of the DNA by means of AT-hook (HMGA) or HMG-box (HMGB) domains. HMGA1a(50-91), HMGB1 box B and HMGB1 box AB have been expressed and purified. High similar binding affinity to an AT-rich DNA sequence containing [AATAAT_ATTATT] has been found by SPR¿biosensor experiments for both proteins. A d[CCAATAATCGCGATTATTGG]2-HMGB1 box B complex was crystallized. The diffraction patterns of the crystal at 2.68 Å resolution presented well-defined spots revealing two diffraction orientations. A series of derivatives of FR60 [4-((4,5-dihydro-1H-imidazol-2-yl)amino)-N-(4-((4,5-dihydro-1Himidazol-2-yl)amino)phenyl)benzamide] have been proved to be high affinity DNA binders with a preference for AT over GC-rich DNA, showing slight selectivity towards sequences containing [AATT] versus [(AT)4] or [AATAAT_ATTATT]. Furthermore, competition assays have demonstrated that JNI18 competes with HMGA1a and HMGB1 for binding to DNA and it is able to displace the proteins from their DNA binding sites. This last interaction is of prime importance, as related proteins have been found to be essential in kinetoplastid parasites. The structure of the bis(2-aminoimidazoline) compound CDIV32 with the oligonucleotide d[AAATTT]2 partially solved at 3.10 Å resolution, displays DNA columns of stacked oligonucleotides forming apseudo-continuous helix packed in a crossed column configuration of DNA helices that are at ~90° to each other. The presence of the drug CDIV32 modulates the organization of duplexes. The crystal structure of the complex of the oligonucleotide d[AAATTT]2 with the lead compound FR60, solved at atomic resolution of 1.25 Å (PDB-ID: 5LIT) by X-ray crystallography, is constituted of stacked oligonucleotides organized as infinite continuous parallel columns, packed in a pseudo-tetragonal configuration. The structure revealed that the drug interacts with the central [AATT] region, covers the minor groove of DNA, displaces bound water and interacts with neighboring DNA molecules as a crosslinking agent. Finally, a functional analysis has been performed on the effect of different bis(2-aminoimidazolines) on T.brucei (>70% AT kDNA) to assess whether parasite DNA was a target for these compounds. By a combination of flow cytometry and imaging techniques such as fluorescence microscopy and TEM, it was demonstrated that these compounds have a clear effect on the S-phase of T. brucei cell cycle by inflicting specific damage on the kinetoplast. It can be concluded that the studied DNA binding compounds FR60 and JNI18 are powerful trypanocides that act directly on the kinetoplast DNA. As the compounds show 100% curative activity in a mouse model of T. b. rhodesiense infection, they are potentially an effective chemotherapeutic agent for the treatment of sleeping sickness.Las secuencias ricas en AT le confieren al ADN propiedades únicas como un alto polimorfismo y flexibilidad. Su abundancia en el genoma de varios patógenos y la selectividad de unión a secuencias AT que presentan ciertas moléculas, han llevado al estudio de ligandos que interactúan con el surco estrecho de DNA con alto contenido en AT. De especial interés son los parásitos kinetoplástidos, como el Trypanosoma brucei, agente causante de la enfermedad del sueño, los cuales se distinguen por la presencia de una estructura de ADN mitocondrial muy rica en AT llamada kinetoplasto. Los ligandos de unión al surco estrecho han ofrecido información primordial sobre el reconocimiento molecular del ADN, proporcionando estrategias terapéuticas útiles. Por ello, se ha elegido como objeto de estudio complejos de ADN ricos en AT con diferentes ligandos, específicamente con proteínas HMG y compuestos bisimidazolinio. Las HMG son una familia de proteínas arquitectónicas que se unen al ADN e influyen en numerosos procesos celulares esenciales. En este trabajo se han estudiado dos subfamilias de las HMG: HMGA y HMGB. Ambas se unen al surco estrecho del ADN mediante diferentes motivos de unión: AT-hook (HMGA) y HMG-box (HMGB). Se han expresado y purificado las formas HMGA1a(50-91), HMGB1 box B y HMGB1 box AB. Mediante SPR, ambas proteínas presentaron una afinidad de unión alta y similar hacia un ADN conteniendo la secuencia [AATAAT_ATTATT]. Se cristalizó el complejo d[CCAATAATCGCGATTATTGG]2- HMGB1 box B. La difracción a una resolución de 2.68 Å presentó reflexiones bien definidas que indicaban dos orientaciones preferenciales. Una serie de derivados del compuesto FR60 [4-((4,5-dihidro-1H-imidazol-2-il)amino)-N-(4-((4,5-dihidro-1H-imidazol-2-il)amino)fenil)benzamida] han demostrado ser ligandos de alta afinidad por secuencias AT con respecto a GC, mostrando cierta preferencia hacia secuencias con [AATT] comparado con [(AT)4] o [AATAAT_ATTATT]. Además, se ha demostrado que el JNI18 compite con la HMGA1a y la HMGB1 en su unión al ADN y es capaz de desplazar a dichas proteínas de sus sitios de unión al ADN. Este hecho es de especial relevancia, ya que se han encontrado proteínas relacionadas que son esenciales en parásitos kinetoplástidos. La estructura del compuesto de bis(2-aminoimidazolinio) CDIV32 con el oligonucleótido d[AAATTT]2 ha sido parcialmente resuelta a una resolución de 3.10 Å. Se encontraron columnas de oligonucleótidos apilados formando una hélice pseudo-continua, empaquetada en una configuración de columnas cruzadas perpendicularmente. La presencia del fármaco CDIV32 modula la organización de las hélices de ADN. Se ha resuelto la estructura cristalográfica del complejo d[AAATTT]2-FR60 a resolución atómica de 1.25 Å (PDB-ID: 5LIT). Se encontraron los oligonucleótidos apilados organizados en columnas infinitas y paralelas en una configuración pseudo-tetragonal. El fármaco interacciona con la región central [AATT], ocupa el surco estrecho del ADN, desplaza las moléculas de agua presentes e interactúa con moléculas de ADN vecinas como un agente entrecruzador. Finalmente, se ha realizado un análisis funcional del efecto de diferentes compuestos bis(2-aminoimidazolinio) en T. brucei (con >70% de AT en su kDNA) para evaluar si el ADN del parásito es una diana para estos compuestos. Se ha estudiado su efecto in vitro mediante una combinación decitometría de flujo y técnicas como microscopía de fluorescencia y TEM. Los resultados permitieron demostrar que estos compuestos tienen un efecto claro sobre la fase S del ciclo celular de T. brucei al dañar específicamente el kinetoplasto. Se ha podido concluir que los compuestos FR60 y JNI18 son potentes tripanocidas que actúan directamente sobre el ADN del kinetoplasto. Ya que los compuestos muestran una actividad curativa del 100% en un modelo de ratón infectado por T. b. rhodesiense, representan un agente quimioterapéutico potencialmente eficaz para el tratamiento de la enfermedad del sueño.Postprint (published version

Non-antimicrobial strategies for the prevention and treatment of infections by multidrug-resistant gram-negative bacilli

Due to the increased of antimicrobial resistance rates and the difficulty of having effective treatment for infections caused by Gram-negative bacilli (GNB) such as Acinetobacter baumannii, Pseudomonas aeruginosa and Escherichia coli, it is necessary to develop non-antimicrobial therapeutic alternatives, which can be used together with the scarce and non-optimal antimicrobial available. In this doctoral thesis, and in order to stop the evolution of the bacterial infection, we aimed to evaluate two therapeutic alternatives: i) blocking the virulence factors of A. baumannii, P. aeruginosa and E. coli and ii) modulating the host immune system. Regarding the first therapeutic approach, we performed the design and evaluation of outer membrane protein A (OmpA) inhibitors on the interaction of A. baumannii, P. aeruginosa and E. coli with the host to block the mechanisms by which this protein produces the infection. Thus, we studied in vitro the effect of the lead peptide AOA-2 on the interaction between A. baumannii, P. aeruginosa and E. coli and human lung epithelial cells (A549) by adherence, immunofluorescence, fibronectin binding, and cell viability assays, and also we tested the effect of AOA-2 on biofilm formation by GNB. In vivo, the therapeutic efficacy of AOA-2 against A. baumannii, P. aeruginosa and E. coli was evaluated. Moreover, the synergy between AOA-2 and colistin by microdilution assay and time-kill curves was studied, and the outer membrane proteins profile in the presence or absence of the AOA-2 was analyzed. Consequently, we constructed an A. baumannii knockout deficient in the omp25 gene and its complemented strain to perform the same experiments. Finally, we evaluated in vivo the therapeutic efficacy of AOA-2 in combination with sub-optimal doses of colistin in peritoneal sepsis caused by A. baumannii. We found that AOA-2 prevented the adhesion of A. baumannii, P. aeruginosa and E. coli to A549 cells protecting them from death, and also reduced biofilm formation by these pathogens. In addition, in the murine peritoneal sepsis model caused by A. baumannii, P. aeruginosa and E. coli, AOA-2 treatment significantly reduced bacteremia, bacterial load in spleen and lung, and mice mortality rates. Regarding the combination of AOA-2 with colistin, the presence of AOA-2 increases the susceptibility of colistin MICs for colistin-susceptible and colistin-resistant A. baumannii strains. Time-kill curves showed a synergistic activity between AOA-2 and colistin, and the protein profile exhibited an overexpression of the Omp25 protein in the strains treated with AOA-2. In vivo, AOA-2 in combination with colistin reduced bacterial spleen and lung loads, bacteremia and mortality rates, in comparison with the monotherapy with colistin. Regarding the second therapeutic approach, we evaluated the effect of lysophosphatidylcholine (LPC), a chemoattractant immunomodulatory factor which stimulates cells from the immune system, as an adjuvant treatment with antimicrobials to treat infections caused by susceptible and MDR strains of A. baumannii and P. aeruginosa in experimental murine models of peritoneal sepsis and pneumonia. Pharmacokinetics and pharmacodynamics parameters of colistin, tigecycline, imipenem and ceftazidime, and minimal lethal dose (MLD) of each strain were determined. In murine experimental models of peritoneal sepsis and pneumonia, mice were pretreated with LPC, infected with MLD of the correspondence strain, and treated or not with antimicrobials. We found that LPC in combination with colistin, tigecycline or imipenem shows beneficial effects in infections caused by susceptible and MDR A. baumannii. Furthermore, the combination of LPC with ceftazidime or imipenem improves the prognosis of infections caused by MDR P. aeruginosa. The data of this doctoral thesis indicate that both the blocking of bacterial virulence factors and the stimulation of the immune system with AOA-2 and LPC, respectively, alone or in combination with antimicrobials, could protect against infections by GNB.Premio Extraordinario de Doctorado U

Formación continua e igualdad de oportunidades. Una aproximación al CEPA de Medina del Campo

El presente documento corresponde a un TFG de Educación Social. Este TFG está basado en la temática de formación continua e igualdad de oportunidades. Para el desarrollo de este tema se realiza un estudio consistente en una aproximación a un centro de educación de personas adultas de la villa de Medina del Campo. Para la elaboración de este TFG se lleva a cabo como punto inicial una introducción, para centralizar el tema a tratar, así como el planteamiento de los objetivos que se desean conseguir. A continuación se lleva a cabo una fundamentación teórica para conceptualizar los términos básicos a tratar en este estudio. Posteriormente se explica el proceso metodológico llevado a cabo. Por último se exponen los resultados obtenidos del estudio del CEPA, así como las conclusiones y recomendaciones que se consideran oportunas.Grado en Educación Socia

Estudio estructural de la unión de ADN rico en adeninas y timinas con la proteína HMGA1a y con fármacos específicos de unión al surco estrecho del ADN

Las actividades relacionadas con el ADN como la transcripción, replicación, recombinación y reparación implican cambios en la estructura del ADN y en la organización de la cromatina. Estos cambios estructurales dependen de su interacción con proteínas. Las proteínas HMGA1 (High Mobility Group A1) son miembros de una superfamilia de proteínas de baja masa molecular, se encuentran en el núcleo de las células y modifican la conformación espacial del ADN. Actúan como factores de transcripción arquitectónicos regulando la expresión de numerosos genes. De esta manera influyen en muchos procesos celulares como el crecimiento, el desarrollo embrionario, la diferenciación, la proliferación y la muerte celular. Por otro lado, este grupo de proteínas está relacionado con algunos procesos que afectan negativamente el desarrollo normal de la célula como la integración de los retrovirus en la cromatina, la inducción de la transformación neoplásica y la promoción de la metástasis, participando así en procesos celulares patológicos como la obesidad, la diabetes, la arteriosclerosis y el cáncer. Los genes de la proteína HMGA1a humana son altamente expresados durante la embriogénesis y prácticamente en todos los cánceres agresivos humanos. Las interacciones HMGA1a-ADN se dan a través de los motivos de unión al ADN denominados AT-hooks, los cuales se unen preferentemente a regiones ricas en AT (adeninas y timinas), en el surco estrecho del ADN. Las proteínas HMGA1a cuentan con tres motivos AT-hooks. Asimismo, se han encontrado una variedad de moléculas pequeñas, naturales o sintéticas, que interaccionan con secuencias de ADN en el mismo sitio de reconocimiento que las proteínas HMGA1a, es decir, drogas que preferentemente se unen al surco estrecho del ADN en regiones ricas en adenina y timina. Para entender mejor el mecanismo por el cual estas proteínas y fármacos se unen al surco estrecho del ADN es necesario determinar la estructura tridimensional de sus complejos con ADN. Con ello, es posible proporcionar información valiosa para el estudio de las patologías relacionadas con la sobreexpresión de la HMGA1a y el diseño de nuevos tipos de agentes terapéuticos

PLTOOL: a knowledge engineering tool for planning and learning

Artificial intelligence (AI) planning solves the problem of generating a correct and efficient ordered set of instantiated activities, from a knowledge base of generic actions, which when executed will transform some initial state into some desirable end-state. There is a long tradition of work in AI for developing planners that make use of heuristics that are shown to improve their performance in many real world and artificial domains. The developers of planners have chosen between two extremes when defining those heuristics. The domain-independent planners use domain-independent heuristics, which exploit information only from the ‘syntactic’ structure of the problem space and of the search tree. Therefore, they do not need any ‘semantic’ information from a given domain in order to guide the search. From a knowledge engineering (KE) perspective, the planners that use this type of heuristics have the advantage that the users of this technology need only focus on defining the domain theory and not on defining how to make the planner efficient (how to obtain ‘good’ solutions with the minimal computational resources). However, the domain-dependent planners require users to manually represent knowledge not only about the domain theory, but also about how to make the planner efficient. This approach has the advantage of using either better domain-theory formulations or using domain knowledge for defining the heuristics, thus potentially making them more efficient. However, the efficiency of these domain-dependent planners strongly relies on the KE and planning expertise of the user. When the user is an expert on these two types of knowledge, domain-dependent planners clearly outperform domain-independent planners in terms of number of solved problems and quality of solutions. Machine-learning (ML) techniques applied to solve the planning problems have focused on providing middle-ground solutions as compared to the aforementioned two extremes. Here, the user first defines a domain theory, and then executes the ML techniques that automatically modify or generate new knowledge with respect to both the domain theory and the heuristics. In this paper, we present our work on building a tool, PLTOOL (planning and learning tool), to help users interact with a set of ML techniques and planners. The goal is to provide a KE framework for mixed-initiative generation of efficient and good planning knowledge.This work has been partially supported by the Spanish MCyT project TIC2002-04146-C05-05, MEC project TIN2005-08945-C06-05 and regional CAM-UC3M project UC3M-INF-05-016.Publicad

Impact of the COVID-19 pandemic on the Spanish commercial real estate market

Artículo de revistaThe COVID-19 pandemic has had a major impact on the recent performance of the Spanish commercial real estate market. In particular, the crisis has led to a sharp decrease in non-residential investment and has triggered a correction in sale prices, transaction numbers and new financing operations. It has also affected Spanish real estate investment trusts specialising in this market, both in terms of the number of vehicles created and of their stock prices and the value of their real estate assets. By contrast, to date there has been no significant deterioration in credit quality linked to the commercial real estate market

Evaluación hidromorfológica de cursos efímeros mediterráneos y propuestas de restauración.

Los cursos de agua efímeros suponen más del 50% de la red hidrológica mediterránea, pero son poco valorados por la sociedad y presentan escasez de datos y carencias en la gestión. Para incrementar el conocimiento científico y detectar los principales impactos que afectan a este tipo de ríos, se evalúa la calidad hidromorfológica de 18 tramos de estudio seleccionados en la región de Murcia mediante la aplicación del Índice Hidrogeomorfológico en su versión para efímeros (IHG-E) y del Índice de Alteración de Ramblas (IAR). Los resultados obtenidos se comparan entre sí y también con los que se obtuvieron en la cuenca del Ebro dentro del mismo proyecto de investigación. A pesar de haber analizado cursos en principio poco alterados, se identifican numerosos impactos, que en su mayor parte son coincidentes entre todos los casos evaluados. A partir de este diagnóstico se proponen medidas conjuntas de restauración.<br /

Zaragoza 2030: Iniciativa de innovación docente para conseguir el sellado del ODS 11 en el Pasaporte 2030

En este trabajo de Fin de Máster se pretende diseñar una iniciativa para trabajar el ODS 11, ciudades y comunidades sostenibles, en un centro educativo concreto con el objetivo de obtener el sellado de este ODS en el Pasaporte 2030, programa creado recientemente por el Departamento de Educación, Cultura y Deporte del Gobierno de Aragón para impulsar la introducción de los ODS en educación. La propuesta planteada consta de cuatro fases en las que se avanza desde el enfoque global hacia un enfoque local que se concreta en el estudio del ODS 11 en la ciudad de Zaragoza. En cada fase se proponen diferentes metodologías activas y participativas como ludificación, aprendizaje basado en juegos y aprendizaje basado en proyectos. Las actividades planteadas contribuyen a alcanzar las competencias clave en ESO, y las competencias profesionales, personales y sociales en los títulos de FP impartidos en el centro educativo para el que se diseña esta iniciativa.<br /