HOUSEHOLD DEMAND FOR PET FOOD AND THE OWNERSHIP OF CATS AND DOGS: AN ANALYSIS OF A NEGLECTED COMPONENT OF U.S. FOOD USE

Demand and Price Analysis,

Crystallization of a Mos1 transposase-inverted-repeat DNA complex: biochemical and preliminary crystallographic analyses

A complex formed between Mos1 transposase and its inverted-repeat DNA has been crystallized. The crystals diffract to 3.25 Å resolution and exhibit monoclinic (P2(1)) symmetry, with unit-cell parameters a = 120.8, b = 85.1, c = 131.6 Å, β = 99.3°. The X-ray diffraction data display noncrystallographic twofold symmetry and characteristic dsDNA diffraction at ∼3.3 Å. Biochemical analyses confirmed the presence of DNA and full-length protein in the crystals. The relationship between the axis of noncrystallographic symmetry, the unit-cell axes and the DNA diffraction pattern are discussed. The data are consistent with the previously proposed model of the paired-ends complex containing a dimer of the transposase

Orbital-Free Molecular Dynamics Simulations of Melting in Na8 and Na20: Melting in Steps

The melting-like transitions of Na8 and Na20 are investigated by ab initio constant energy molecular dynamics simulations, using a variant of the Car-Parrinello method which employs an explicit electronic kinetic energy functional of the density, thus avoiding the use of one-particle orbitals. Several melting indicators are evaluated in order to determine the nature of the various transitions, and compared with other simulations. Both Na8 and Na20 melt over a wide temperature range. For Na8, a transition is observed to begin at approx. 110 K, between a rigid phase and a phase involving isomerizations between the different permutational isomers of the ground state structure. The ``liquid'' phase is completely established at approx. 220 K. For Na20, two transitions are observed: the first, at approx. 110 K, is associated with isomerization transitions between those permutational isomers of the ground state structure which are obtained by interchanging the positions of the surface-like atoms; the second, at approx. 160 K, involves a structural transition from the ground state isomer to a new set of isomers with the surface molten. The cluster is completely ``liquid'' at approx. 220 K.Comment: Revised version, accepted for publication in J. Chem. Phys. The changes include longer simulations for the Na20 microcluster, a more complete comparison to previous theoretical results, and the discussion of some technical details of the method applie

A quantum mechanical approach to establishing the magnetic field orientation from a maser Zeeman profile

Recent comparisons of magnetic field directions derived from maser Zeeman splitting with those derived from continuum source rotation measures have prompted new analysis of the propagation of the Zeeman split components, and the inferred field orientation. In order to do this, we first review differing electric field polarization conventions used in past studies. With these clearly and consistently defined, we then show that for a given Zeeman splitting spectrum, the magnetic field direction is fully determined and predictable on theoretical grounds: when a magnetic field is oriented away from the observer, the left-hand circular polarization is observed at higher frequency and the right-hand polarization at lower frequency. This is consistent with classical Lorentzian derivations. The consequent interpretation of recent measurements then raises the possibility of a reversal between the large-scale field (traced by rotation measures) and the small-scale field (traced by maser Zeeman splitting).Comment: 10 pages, 5 Figures, accepted for publication in MNRA

Assessing housing quality and its impact on health, safety and sustainability

Background The adverse health and environmental effects of poor housing quality are well established. A central requirement for evidence-based policies and programmes to improve housing standards is a valid, reliable and practical way of measuring housing quality that is supported by policy agencies, the housing sector, researchers and the public. Methods This paper provides guidance on the development of housing quality-assessment tools that link practical measures of housing conditions to their effects on health, safety and sustainability, with particular reference to tools developed in New Zealand and England. Results The authors describe how information on housing quality can support individuals, agencies and the private sector to make worthwhile improvements to the health, safety and sustainability of housing. The information gathered and the resultant tools developed should be guided by the multiple purposes and end users of this information. Other important issues outlined include deciding on the scope, detailed content, practical administration issues and how the information will be analysed and summarised for its intended end users. There are likely to be considerable benefits from increased international collaboration and standardisation of approaches to measuring housing hazards. At the same time, these assessment approaches need to consider local factors such as climate, geography, culture, predominating building practices, important housing-related health issues and existing building codes. Conclusions An effective housing quality-assessment tool has a central role in supporting improvements to housing. The issues discussed in this paper are designed to motivate and assist the development of such tools

The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein

Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Publisher PDFPeer reviewe

Local forest structure variability increases resilience to wildfire in dry western U.S. coniferous forests.

A 'resilient' forest endures disturbance and is likely to persist. Resilience to wildfire may arise from feedback between fire behaviour and forest structure in dry forest systems. Frequent fire creates fine-scale variability in forest structure, which may then interrupt fuel continuity and prevent future fires from killing overstorey trees. Testing the generality and scale of this phenomenon is challenging for vast, long-lived forest ecosystems. We quantify forest structural variability and fire severity across >30 years and >1000 wildfires in California's Sierra Nevada. We find that greater variability in forest structure increases resilience by reducing rates of fire-induced tree mortality and that the scale of this effect is local, manifesting at the smallest spatial extent of forest structure tested (90 × 90 m). Resilience of these forests is likely compromised by structural homogenisation from a century of fire suppression, but could be restored with management that increases forest structural variability

Hydrophobic Ligand Binding by Zn-α_2-glycoprotein, a Soluble Fat-depleting Factor Related to Major Histocompatibility Complex Proteins

Zn-alpha2-glycoprotein (ZAG) is a member of the major histocompatibility complex (MHC) class I family of proteins and is identical in amino acid sequence to a tumor-derived lipid-mobilizing factor associated with cachexia in cancer patients. ZAG is present in plasma and other body fluids, and its natural function, like leptin's, probably lies in lipid store homeostasis. X-ray crystallography has revealed an open groove between the helices of ZAG's alpha1 and alpha2 domains, containing an unidentified small ligand in a position similar to that of peptides in MHC proteins (Sanchez, L. M., Chirino, A. J., and Bjorkman, P. J. (1999) Science 283, 1914-1919). Here we show, using serum-derived and bacterial recombinant protein, that ZAG binds the fluorophore-tagged fatty acid 11-(dansylamino)undecanoic acid (DAUDA) and, by competition, natural fatty acids such as arachidonic, linolenic, eicosapentaenoic, and docosahexaenoic acids. Other MHC class I-related proteins (FcRn, HFE, HLA-Cw*0702) showed no such evidence of binding. Fluorescence and isothermal calorimetry analysis showed that ZAG binds DAUDA with Kd in the micromolar range, and differential scanning calorimetry showed that ligand binding increases the thermal stability of the protein. Addition of fatty acids to ZAG alters its intrinsic (tryptophan) fluorescence emission spectrum, providing a strong indication that ligand binds in the expected position close to a cluster of exposed tryptophan side chains in the groove. This study therefore shows that ZAG binds small hydrophobic ligands, that the natural ligand may be a polyunsaturated fatty acid, and provides a fluorescence-based method for investigating ZAG-ligand interactions

Water facilities in retrospect and prospect: An illuminating tool for vehicle design

Water facilities play a fundamental role in the design of air, ground, and marine vehicles by providing a qualitative, and sometimes quantitative, description of complex flow phenomena. Water tunnels, channels, and tow tanks used as flow-diagnostic tools have experienced a renaissance in recent years in response to the increased complexity of designs suitable for advanced technology vehicles. These vehicles are frequently characterized by large regions of steady and unsteady three-dimensional flow separation and ensuing vortical flows. The visualization and interpretation of the complicated fluid motions about isolated vehicle components and complete configurations in a time and cost effective manner in hydrodynamic test facilities is a key element in the development of flow control concepts, and, hence, improved vehicle designs. A historical perspective of the role of water facilities in the vehicle design process is presented. The application of water facilities to specific aerodynamic and hydrodynamic flow problems is discussed, and the strengths and limitations of these important experimental tools are emphasized