First Report of Grapevine rupestris stem pitting-associated virus in Wild Grapevines (Vitis vinifera spp. sylvestris) in Tunisia

Wild grapevines (Vitis vinifera spp. sylvestris) grow in the northern part of Tunisia, and can potentially be natural reservoirs of pathogens including viruses. Grapevine Rupestris stem pitting-associated virus (GRSPaV), a member of the genus Foveavirus in the family of Betaflexiviridae. It is present in grapevines worldwide and is associated with rupestris stem pitting (RSP) and grapevine vein necrosis (Meng et al. 2013). The virus has been detected in the pollen of infected grapevines (Rowhani et al. 2000), but its spread through pollen is not confirmed, although it is transmitted by seed from infected mother plants to their progeny (Lima et al. 2006b). In Tunisia, GRSPaV is very common in table grape cultivars (Soltani et al. 2013) but no data are currently available on the presence of viruses in Tunisian wild grapevines, which can play a role in the dissemination of viruses to the cultivated grapevines. To address this knowledge gap, a survey was carried out in the mountain forests of northern Tunisia. Samples of wild grapevines were labeled during the vegetative season and dormant canes from 84 accessions (male and female plants) were collected during winter. All samples were tested by RT-PCR for the presence of GRSPaV using primers RSP-48 (5'- AGCTGGGATTATAAGGGAGGT-3') and RSP-49 (5'- CCAGCCGTTCCACCACTAAT-3') (Lima et al. 2006a) for the amplification of a 331 bp fragment of the coat protein (CP) gene. Results showed that 51% (43/84) of the samples were infected by GRSPaV. In order to confirm the presence of this virus in wild grapevines, two positive samples (VS56 and VS70) were tested by RT-PCR using primers RSP-52 (5'-TGAAGGCTTTAGGGGTTAG-3') and RSP-53 (5'-CTTAACCCAGCCTTGAAAT-3') (Rowhani et al. 2000) to amplify the complete CP. Isolate VS56 was from a male plant in northern Tunisia and isolate VS70 was from a female plant in the northeast of the country. PCR products of these two isolates were cloned and sequenced in both directions. The Tunisian GRSPaV isolates VS56 (LT855232) and VS70 (LT855235) shared 84% nucleotide sequence identity. Isolate VS56 had 85-86% identity with all GRSPaV sequences available in GenBank, whereas VS70 showed 93-99% identities with isolates SK704-A (KX274274) and ORPN12 (FJ943318). To further confirm the presence of GRSPaV in wild grapevines, the same two samples were tested by RT-PCR using primers McK1U (AGGGATTGGCTGTTAGATGTT) and McK1D (CTTCAGGCAACCCCAAAAA) (Nolasco et al. 2000) to amplify a 355 bp fragment of the RNA-dependent RNA polymerase domain. Isolates VS56 (LT906626) and VS70 (LT906636) shared 89% nucleotide sequence identity. Isolate VS56 had 89-94% identity with isolates SK30 (KX274277) and GRSPaV-MG (FR691076) while VS70 showed 94-95% identity with isolates Tannat-Rspav1 (KR528585) and GRSPaV-GG (JQ922417). To our knowledge, this is the first report of GRSPaV in wild grapevines in Tunisia

The occurrence of grapevine rugose wood disease in Algeria

Rugose wood disease constitutes one of the major grapevine disease complexes causing significant economic damage worldwide. It is widely distributed in all grapevine growing areas of the world and comprised of four individual syndromes, which may be caused by different viruses. These syndromes are Corky bark, LN 33 stem grooving, Kober stem grooving and Rupestris stem pitting (RSP). The present study focuses on the prevalence of three viruses associated with rugose wood complex (RWC) in Algeria. Field inspections and collection of symptomatic samples were conducted on autumn 2012 in the table wine and autochthone accession in the western and central regions of Algeria. A total of 202 samples were tested by RT-PCR using specific primers for Grapevine virus A (GVA), Grapevine virus D (GVD) and Grapevine rupestris stem pitting associated virus (GRSPaV). The results of RT-PCR indicated the presence of the viruses GVA, GVD and GRSPaV with 68,81% (139 out of 202 infected samples) total average infection rate. The results also indicated the predominance of GRSPaV compared to the prevalence of GVA and GVD with an infection rate of 57,92% vs. 36,63% (74 out of 202) and 2,97% (6 out of 202), respectively. Mixed infections of these three viruses were not observed in any of the samples analysed, however the mixed infection of GVA and GRSPaV was noted with a high rate of 26.73%. The grapevine cultivars; Kings Rubi, Carignan and Mersguerra were the most infected, while the Alicante Bouschet cultivar presented the lowest infection rate. To the best of our knowledge, the present study reports for the first time on the presence of GVD in Algeria

Identification of phytoplasmas and auchenorryncha in Tunisian vineyards

To verify the risk that plant pathogens such as phytoplasmas could have been introduced with infected propagation material, a preliminary investigation for the presence of phytoplasmas and their insect vectors in the main Tunisian viticultural regions was carried out. To identify phytoplasmas and leafhopper fauna several survey have been carried out on grapevine and spontaneous plant species in the main grapevine growing regions of Tunisia, i.e. Rafraf, Baddar, Mraissa, Belli, Gobba, and Bousalem. A total of 1,109 insect specimens were collected and 30 species were identified, 25 Cicadomorpha and 5 Fulgoromorpha. The 82.58% of the leafhopper species recorded are reported either as vectors of viruses or of phytoplasmas or direct damaging pests, while the 17.49% remaining do not have an important role in field management. In some of the collected grapevine materials aster yellows phytoplasmas (16SrI-B) were identified, confirming previous reports

Chemical composition and functional properties of gum exudates from the trunk of the almond tree (Prunus dulcis)

The physicochemical components and functional properties of the gum exudates from the trunk of the almond tree (Prunus dulcis) have been investigated, along with the emulsification and foaming properties. The gum exudates are composed on dry weight basis by 2.45% of proteins, 0.85% of fats and 92.36% of carbohydrates. The latter consist of arabinose, xylitol, galactose and uronic acid (46.8 : 10.9 : 35.5 : 6.0 mass ratio) with traces of rhamnose, mannose and glucose. Moreover, gum exudates are rich in minerals, such as sodium, potassium, magnesium, calcium and iron. The emulsifying capacity was studied for a 20% w/w olive oil in water emulsion as a function of gum concentration (from 3% to 12% w/w in the aqueous phase) as well as pH levels (from 3.0 to 10.0). The most stable and homogeneous emulsion was prepared with an 8% w/w aqueous almond gum solution at a pH between 5.0 and 8.0. In particular, for the same formulation, the emulsion processed by high pressure homogenization (5 passes at 200 MPa) resulted to be extremely stable under accelerated ageing, exhibiting no significant change in droplet size distribution for 14 days at 55 degrees C. All the tested systems exhibited an extremely low foaming capacity

A Comparative Study on Physicochemical, Rheological and Surface Tension Properties of Tunisian Jujube (Zizyphus lotus L.) Seed and Vegetable Oils

The physicochemical, rheological, surface tension and emulsifying properties of Tunisian jujube (Zizyphus lotus L.) seed oil were investigated and compared with six edible vegetable oils ( olive, corn, soybean, sunflower, groundnut and rapeseed). These results showed that total phospholipids and total tocopherols contents were significantly higher (P < 0.05) in jujube seed oil than those in edible vegetable oils. It was also shown that all oil samples exhibited Newtonian behaviors at shear rate ranged from 10 to 1000 s-1 and the highest viscosity eta was observed in jujube seed oil, followed by olive, rapeseed, groundnut, corn, soybean and sunflower oils. In addition, the interfacial tension value of jujube seed oil was significantly lower (17.56 mN/m) than the corresponding of edible vegetable oils. The emulsions were prepared with different type of oil samples and they were kept for 60 days under 4, 30 and 55 degrees C for stability test. Our results showed that mean droplet size d4,3 of jujube seed oil emulsion was significantly smaller ( P < 0.05) than those of vegetable oils studied. Moreover, jujube seed oil emulsions were stable for 2 months with an average diameter of 213.34 nm. According to the results, jujube seed oil has rheological, interfacial tension, and emulsifying properties that may become interesting for specific applications in several segments of food, cosmetic, pharmaceutical and agrichemical industries

Prevalence and Genetic Diversity of Grapevine Virus D in Tunisia

The prevalence and the genetic diversity of grapevine virus D (GVD) isolates from rootstocks, wine and table grape varieties grown in Tunisia were studied. RT-PCR assays performed on the coat protein gene (CP) showed the presence of GVD in 31.5% of the 403 samples tested. The highest rate of infection was found in table grapes (56.5%), followed by autochthonous table grapes (24.1%), wine grapes (20.8%) and rootstocks (12.5%).&nbsp; Sequences and phylogenetic analyses of the partial CP genes of 14 GVD isolates showed nucleotide identities that ranged from 84% to 99%. The&nbsp; Tunisian GVD-isolates segregated in 3 phylogenetic groups together with international isolates reported in GenBank. The present study extends our&nbsp; knowledge of the presence of GVD in Tunisian vines and on its genetic diversity, which is useful for developing broad-spectrum molecular&nbsp; diagnostics (RT-PCR) capable of detecting the different isolates infecting vines