Nano and microparticles as carriers for alveolar macrophage targeting in pulmonary tuberculosis therapy

Tuberculosis (TB) is a leading infectious cause of death worldwide, even though a vaccine and several effective antibiotics are available for its prevention and treatment. Global TB control is very difficult due to various factors, including late diagnosis and patient non-compliance to long-term treatments, which leads to a high incidence of extensive resistance to effective anti-TB drugs. Overall, there are significant challenges associated with conventional TB therapy, including (i) drug resistance and toxicity; (ii) patient non-compliance, given the long-term therapy and severe side effects; (iii) and drug-drug interactions, particularly with antiretroviral drugs in patients co-infected with TB and HIV. Thus, the situation has come to a point where the development of novel intervention strategies is urgently needed. In this context, the pulmonary delivery of anti-TB drugs is a promising approach to treat lung TB. The disease represents approximately 80% of total cases, and thus the lung has been explored as an effective route for the delivery of drugs. This strategy not only allows targeting the infected organ instantly, but it can also reduce the systemic adverse effects of the antibiotics, which are main reasons for patient non-compliance. However, pulmonary drug delivery faces some limitations related with the proper airway structure, local degradation of drugs, and mucociliary clearance. In order to overcome some of these limitations of lung delivery, drug microencapsulation appears as a potential approach. In this sense, this work aimed at producing inhalable microparticles that efficiently associate two anti-TB drugs, isoniazid (INH) and/or rifabutin (RFB), for an application in pulmonary TB therapy. Fucoidan (FUC) and chitosan (CS) were the biomaterials selected to compose the matrix of the carriers. FUC is a polysaccharide composed of fucose units that has been reported to be specifically recognised by surface receptors of alveolar macrophages (the host cells of Mycobacterium tuberculosis). Likewise, CS is a polysaccharide composed of N-acetylglucosamine and D-glucosamine residues, the former being also specifically recognised by macrophages, according to the literature. This recognition by macrophages is believed to potentiate phagocytosis. The first approach involved the production of nanoparticles and it was considered that subsequent microencapsulation of the nanocarriers would be necessary to overcome aerodynamic limitations of nanosized carriers and their ability to reach the alveolar zone. Nanoparticles were spontaneously obtained by complexing FUC with CS, resulting from several formulations (polymeric mass ratio varying from 4:1 to 1:4). The produced unloaded FUC/CS nanoparticles presented average size range of 159 – 266 nm, PdI ranging between 0.21 and 0.36, and zeta potential varying from -39 mV to +12 mV, following the alteration of the mass ratios. The ability of FUC/CS nanoparticles to associate anti-TB drugs was assessed, and tests initiated with the incorporation of RFB, which was associated to obtain final polymer/drug mass ratio of 10/1 (w/w). Several attempts were made unsuccessfully, and therefore the work continued using another production method. Nanoprecipitation technique was then used, resulting in FUC nanoparticles and CS nanoparticles with mean size of 500 nm and 700 nm, respectively. However, the obtained nanoparticles showed little uniformity in size, indicated by PdI values, varying between 0.55 and 0.83. Moreover, an optimal protocol to obtain FUC- and CS-based nanoparticles that efficiently encapsulate INH and RFB could not be established. Taking into consideration the unsuccessful nanoparticle production and time restraints to accomplish the aims of the PhD plan, it was decided to focus the study on the development of polymeric microparticles. Microparticles were produced by spray-drying, associating the model drugs (INH and RFB), either separately or in combination. FUC microparticles effectively associated INH (95%) and RFB (81%), separately. Likewise, FUC microparticles loaded with the two anti-TB drugs simultaneously were also successfully produced, demonstrating high drug association efficiency (97% for INH and 95% for RFB). All FUC-based microparticles evidenced favourable aerodynamic properties for deep lung delivery upon inhalation. Single drug-loaded FUC microparticles showed aerodynamic diameter (MMAD) in the range of 2.0–3.8 μm. Likewise, the dual drug-loaded dry powder presented aerodynamic diameter of 3.6–3.9 μm. Overall, the formulations evidenced no cytotoxic effects on human alveolar epithelium cells (A549), although mild toxicity was observed on macrophage-differentiated THP-1 cells at the highest tested concentration (1 mg/mL). Nonetheless, this dose is considered overestimated compared to that effectively observed in vivo. The produced FUC microparticles also exhibited a propensity to be captured by macrophages or macrophage-like cells (target cells) in a dose-dependent manner. Particularly, dual drug-loaded microparticles displayed ability to activate the target cells and, moreover, effectively inhibited mycobacterial growth in vitro, preserving the bactericidal activity of the drugs. In vivo lung administration (BALB/c mice) of unloaded FUC microparticles indicated, in a preliminary assay, that the carriers induced no allergic responses. CS microparticles also associated INH (90%) and RFB (97%) efficiently, in separate formulations, whereas dual drug-loaded formulation resulted in 93% association efficiency for INH and 99% for RFB. All formulations presented adequate properties for deep lung delivery, with aerodynamic diameters ranging between 2.5 and 4 μm. Absence of toxicity was observed in human alveolar epithelium (A549 cells) but, as observed for FUC carriers, the highest tested concentration of microparticles (1 mg/mL) decreased the viability of macrophage-differentiated THP-1 cells upon 24 h exposure. This dose is however believed to be overestimated, as aforementioned. CS microparticles further evidenced strong ability to be internalised by macrophage-like cells (percentage of phagocytosis up to 99.9%), regardless of the dose. Yet, dual drug-loaded carriers induced macrophage activation and effectively inhibited the growth of mycobacteria in vitro. Moreover, the biomaterial (CS) was well tolerated by BALB/c mice upon pulmonary administration of unloadead CS microparticles. Overall, the obtained data gave positive indications on the potential of the proposed systems for an application as inhalable tuberculosis therapy

Interferência de RNA direcionada ao canal de potássio Eag1 : efeitos sobre a expressão gênica e viabilidade celular do glioma

Dissertação (mestrado)—Universidade de Brasília, Faculdade de Ciências da Saúde, Programa de Pós-Graduação em Ciências da Saúde, 2012.Gliomas representam o tipo de tumor cerebral primário de maior malignidade. Entre as alterações que conferem competência tumoral ao glioma, está o aumento na expressão do canal de potássio hEag1. Na última década, a interferência de RNA (RNAi) tem se destacado como técnica para estudo da função de genes em mamíferos, via silenciamento gênico pós-transcricional. Neste sentido, a técnica de RNAi foi utilizada no atual estudo para silenciar o gene Eag1 em células de glioma. Na primeira etapa deste projeto, foram identificados alvos para RNAi na região codante do gene hEag1 (NM_172362.2), via algoritmo baseado em redes neurais artificiais. Foram identificados 25 alvos de RNAi, com escores variando de 0,82 a 0,87, e selecionados para o atual estudo os dois alvos com maiores escores. Foi realizada síntese química de siRNAs para estes alvos situados nos exons 2 e 8, daí a denominação e2_hEag1 e e8_hEag1. Também foram sintetizados o siRNA controle positivo descrito anteriormente Kv10.1-3 e o controle negativo scramble (Qiagen). Foi inicialmente determinado o ponto temporal (4h, 8h, ou 48h) e a concentração (18,75 nM, 37,5 nM ou 75,0 nM) de maior silenciamento de hEag1, utilizando-se os siRNAs controles transfectados em lipossomas catiônicos. O maior silenciamento foi observado no tempo de 8h pós-transfecção, na menor dosagem testada, 18,75 nM. Nesta condição experimental, foi testado o grau de silenciamento de Eag1 causado pelos dois novos siRNAs, em comparação com o controle positivo Kv10.1-3. Ambos siRNAs desenhados no atual estudo -e2_hEag1 e e8_hEag1 -foram mais efetivos que o controle positivo Kv10.1-3, reduzindo assim o conteúdo relativo de hEag1 em 0,46 vezes e 0,52 vezes, respectivamente, em relação ao valor obtido no controle negativo scramble (p < 0,05). Na última etapa deste estudo, foi avaliado se vetores de expressão de short hairpins RNAs (shRNA) direcionados ao alvo 5´ GTCCACTTGGTCCATGTCCAG 3´ do controle positivo Kv10.1-3 (pKv10.1-3hum_LI), causariam alteração de fenótipo celular, ou seja, redução da viabilidade dos gliomas. O efeito destes vetores de expressão (pKv10.1-3hum_LI ou pScramble, dose de 0,2 µg) sobre a viabilidade de gliomas, em uso isolado ou em combinação com interferon gama (IFN-y, 25 ng/mL ) foi testado pelo ensaio de MTT. A redução de viabilidade obtida com a combinação do vetor pKv10.1-3hum_LI e IFN-y (40,4 %)foi superior àquela obtida com o uso isolado de ambos, 16,0% e 11,4%, nesta ordem (p < 0,05). Este efeito sinérgico não foi observado com o vetor controle negativo pScramble, o que indica tratar-se de efeito sequência-específico, ou seja, dependente da sequência do shRNA expresso pelo vetor pKv10.1-3hum_LI. Em síntese, o presente estudo mostra que é possível silenciar a expressão de hEag1 de gliomas via siRNAs sintéticos. Além disto, revela a importância de hEag1 para a viabilidade celular do glioma, principalmente durante a injúria por IFN-y. No sentido tecnológico, o atual estudo apresenta um protocolo inovador com potencial uso na terapêutica de gliomas, baseado na associação de RNAi sobre hEag1 com o agente imunomodulador IFN-y. ______________________________________________________________________________ ABSTRACTGlioma is the most common type of primary malignant brain tumor. The disease presents poor clinical outcome and the treatment is essentially palliative. Among the genetic changes that confer capability to tumor cells is the hEag1 gene overexpression. RNA interference (RNAi) has rapidly advanced into a practical technique for mammalian gene function studies, through post-transcriptional genetic silencing. The technique was used in the present study to silence hEag1 gene in glioma cells in culture. We first identified RNAi targets in the coding region of hEag1 (NM_172362.2) by using algorithms based on artificial neural networks. Twenty-five hEag1 RNAi targets were found, with scores ranging from 0.82 to 0.87; the two highest rated were selected. They were chemically synthesized as short interfering RNAs (siRNAs), and designated e2_hEag1 and e8_hEag1, according to the targeted exon. Positive and negative siRNA controls were the previously published Kv10.1-3, and the scramble All Star (Qiagen), respectively. We first determined the time-point (4h, 8h, or 48h) and siRNA concentration (18.75 nM, 37.5 nM, or 75.0 nM) that provide the highest silencing effect, by using RT-qPCR. The best hEag1 knock-down occurred at 8h post-transfection with 18.75 nM siRNA concentration. We used this experimental condition to compare the two new siRNAs - e2_hEag1 and e8_hEag1 – with the positive control Kv10.1-3. Both siRNAs in test produced higher silencing effects compared to Kv10.1-3 (p < 0.05). The mRNA fold decrease varied from 0.46 to 0.52, according to each transfected siRNA e2_hEag1 or e8_hEag1, respectively. Finally, we evaluated whether an expressed short hairpin RNA (shRNA) to the same hEag1 Kv10.1-3 target sequence (5´- GTCCACTTGGTCCATGTCCAG 3´) would decrease the glioma cell viability. The expression vectors (pKv10.1-3hum_LI or a scramble control one pScramble, dose 0.2 µg) were transfected into glioma cells, with or without interferon gamma concurrent treatment (IFN- y, 25 ng/mL ) viability was determined by MTT assay. The association of the vector pKv10.1-3hum_LI and IFN- y decreased the glioma cell viability to 40.4%, which surpassed the results obtained from their isolate use, 16.0% and 11.4%, respectively (p<0.05). As pScramble showed no synergism with IFN- y we consider the pKv10.1-3hum_LI effects were sequence-specific. In conclusion, this study showed the ability of two unpublished siRNAs to knock-down hEag1. Our results are in agreement with previous data that established a role for Eag1 in the tumor cell viability. This role seems to be even more important during IFN-y injury. Regarding to biotechnology, this study presents an innovative treatment able to reduce the glioma cell viability, based on the association of shRNA expression vector to hEag1 and the immunomodulatory agent IFN- y

Inhalable fucoidan microparticles combining two antitubercular drugs with potential application in pulmonary tuberculosis therapy

The pulmonary delivery of antitubercular drugs is a promising approach to treat lung tuberculosis. This strategy not only allows targeting the infected organ instantly, it can also reduce the systemic adverse effects of the antibiotics. In light of that, this work aimed at producing fucoidan-based inhalable microparticles that are able to associate a combination of two first-line antitubercular drugs in a single formulation. Fucoidan is a polysaccharide composed of chemical units that have been reported to be specifically recognised by alveolar macrophages (the hosts of Mycobacterium). Inhalable fucoidan microparticles were successfully produced, effectively associating isoniazid (97%) and rifabutin (95%) simultaneously. Furthermore, the produced microparticles presented adequate aerodynamic properties for pulmonary delivery with potential to reach the respiratory zone, with a mass median aerodynamic diameter (MMAD) between 3.6-3.9 mu m. The formulation evidenced no cytotoxic effects on lung epithelial cells (A549), although mild toxicity was observed on macrophage-differentiated THP-1 cells at the highest tested concentration (1 mg/mL). Fucoidan microparticles also exhibited a propensity to be captured by macrophages in a dose-dependent manner, as well as an ability to activate the target cells. Furthermore, drug-loaded microparticles effectively inhibited mycobacterial growth in vitro. Thus, the produced fucoidan microparticles are considered to hold potential as pulmonary delivery systems for the treatment of tuberculosis.Portuguese Foundation for Science and Technology [PTDC/DTP-FTO/0094/2012, UID/Multi/04326/2013, UID/BIM/04773/2013]; CAPES-Brazil [BEX 1168/13-4

Inhalable chitosan microparticles for simultaneous delivery of isoniazid and rifabutin in lung tuberculosis treatment

The direct delivery of antibiotics to the lung has been considered an effective approach to treat pulmonary tuberculosis, which represents approximately 80% of total cases. In this sense, this work aimed at producing inhalable chitosan microparticles simultaneously associating isoniazid and rifabutin, for an application in pulmonary tuberculosis therapy. Spray-dried chitosan microparticles were obtained with adequate flow properties for deep lung delivery (aerodynamic diameter of 4 µm) and high drug association efficiencies (93% for isoniazid and 99% for rifabutin). The highest concentration of microparticles that was tested (1 mg/mL) decreased the viability of macrophage-differentiated THP-1 cells to around 60% after 24 h exposure, although no deleterious effect was observed in human alveolar epithelial (A549) cells. The release of LDH was, however, increased in both cells. Chitosan microparticles further evidenced capacity to activate macrophage-like cells, inducing cytokine secretion well above basal levels. Moreover, the propensity of macrophages to internalize microparticles was demonstrated, with uptake levels over 90%. Chitosan microparticles also inhibited bacterial growth by 96%, demonstrating that the microencapsulation preserved drug antibacterial activity in vitro. Overall, the obtained data suggest the potential of chitosan microparticles for inhalable lung tuberculosis therapy.PTDC/DTP-486 FTO/0094/2012info:eu-repo/semantics/publishedVersio

HIGIENE PESSOAL: A IMPORTÂNCIA DE ESTUDAR O CORPO HUMANO

Higiene pessoal são medidas tomadas para a preservação da saúde e prevenção contra doenças. Partindo desse princípio os hábitos de higiene pessoal devem ser ensinados às crianças desde cedo a fim de desenvolver sua conscientização. Por meio da aplicação de questionários, buscamos obter informações sobre a atual situação higiênica em duas escolas do município de Cuiabá. E de acordo com os resultados obtidos sugerir soluções razoáveis aos problemas de higiene pessoal em alunos de 06 a 15 anos de idade. Dos 61 alunos 25 eram do sexo masculino e 36 do sexo feminino. Dos 25 meninos, 4% disseram que escovam os dentes uma vez ao dia, 16% escovam os dentes duas vezes ao dia, 64% escovam os dentes três vezes ao dia e 16% escovam os dentes mais de três vezes ao dia. Das 36 meninas, 2,7% disseram que escovam os dentes uma vez ao dia, 16,6% disseram que escovam os dentes duas vezes ao dia, 61,1% disseram que escovam os dentes três vezes ao dia e 19,4% disseram que escovam os dentes mais de três vezes ao dia. Dos 25 meninos, 45,8% disseram que costumam usar o fio dental após a escovação, 25% disseram que não fazem uso do fio dental, 29,1% às vezes fazem uso do fio dental após a escovação. Das 36 meninas, 47,2% disseram que utilizam o fio dental após a escovação, 22,2% disseram que não utilizam e 30,5% às vezes utilizam o fio dental após a escovação. Dos 25 meninos, 52% costumam utilizar antisséptico bucal durante a escovação, 16% não costumam utilizar o enxaguante bucal e 32% às vezes fazem o uso do mesmo. Das 36 meninas, 41,6% costumam utilizar antisséptico bucal após a escovação, 25% não o utilizam e 33,3% às vezes utilizam o enxaguante bucal após a escovação. Com base nos resultados obtidos podemos concluir que a maioria dos alunos de ambas as escolas possuem um bom hábito de higiene pessoal

No Morphometric Distinction between the Host Constrictotermes cyphergaster (Silvestri) (Isoptera: Termitidae, Nasutitermitinae) and its Obligatory Termitophile Corotoca melantho Schiødte (Coleoptera: Staphylinidae)

Different species may live in termite nests, cohabiting in close association with the host colony or occupying nest cavities without direct contact with the host. The strategy of termitophile organisms to become integrated into termite societies include appeasement through chemical, morphological and/or behavioral mimicry. We investigated the hypothesis that there is a morphological mimicry between the obligate termitophile Corotoca melantho (Coleoptera: Staphylinidae) and workers of its termite host Constrictotermes cyphergaster (Isoptera: Termitidae). Pictures of thirty-one C. cyphergaster workers and C. melantho individuals were taken in top and side views and converted into thin-plate splines. Four homologous landmarks and five semilandmarks (reference points) were marked on the head and abdomen of both species and digitized. The body shape of both species are morphometrically similar, so there is no discrimination between specimens of termitophile beetles and worker of termite hosts. Body size of termite hosts is responsible for 20% to 30% of body shape variation, while the body size of termitophiles beetle affects near 50% to 60% body shape. However, termitophiles body shape had a greater variation than worker termites. This is the first study to compare morphological similarity among termites and termitophiles using morphometric geometry. Our results indicated the existence of a morphological mimicry between C. cyphergaster and C. melantho

Sulfated seaweed polysaccharides as multifunctional materials in drug delivery applications

In the last decades, the discovery of metabolites from marine resources showing biological activity has increased significantly. Among marine resources, seaweed is a valuable source of structurally diverse bioactive compounds. The cell walls of marine algae are rich in sulfated polysaccharides, including carrageenan in red algae, ulvan in green algae and fucoidan in brown algae. Sulfated polysaccharides have been increasingly studied over the years in the pharmaceutical field, given their potential usefulness in applications such as the design of drug delivery systems. The purpose of this review is to discuss potential applications of these polymers in drug delivery systems, with a focus on carrageenan, ulvan and fucoidan. General information regarding structure, extraction process and physicochemical properties is presented, along with a brief reference to reported biological activities. For each material, specific applications under the scope of drug delivery are described, addressing in privileged manner particulate carriers, as well as hydrogels and beads. A final section approaches the application of sulfated polysaccharides in targeted drug delivery, focusing with particular interest the capacity for macrophage targeting

Empregabilidade: entendimento e preparação dos acadêmicos de fisioterapia da PUC Goiás

Resumo: os objetivos deste estudo foram verificar o que os alunos do curso de Fisioterapia da Pontifícia Universidade Católica de Goiás - GO entendem sobre o conceito â??empregabilidadeâ? e identificar as ações que estão sendo desenvolvidas pelos mesmos para adquirirem-na. Trata-se de um estudo quantitativo, com 49 acadêmicos do último ano do curso. Evidenciou-se que os acadêmicos possuem uma visão ampla em relação ao conceito de empregabilidade e que os mesmos, embora de forma restrita, estão procurando se preparar para atingi-la. Palavras-chave: Acadêmicos. Empregabilidade. Fisioterapia

Spray-dried fucoidan microparticles for pulmonary delivery of antitubercular drugs

Pulmonary tuberculosis accounts for 80% of cases and the delivery of antitubercular drugs into the lungs allows targeting the infected organ and, possibly, reducing systemic drug toxicity. This work aimed at using fucoidan as matrix of inhalable microparticles that associate two first-line antitubercular drugs, for an application in pulmonary tuberculosis therapy. Fucoidan is composed of fucose and sulphated sugar residues, moieties described as being recognised by surface receptors of alveolar macrophages, which host mycobacteria. Inhalable fucoidan microparticles loaded with antitubercular drugs were successfully produced with high association efficiencies of either isoniazid (95%) or rifabutin (81%). The microparticles evidenced no cytotoxicity on lung epithelial cells (A549). However, rifabutin-loaded microparticles showed a certain degree of toxicity on macrophage-like cells (THP-1) at the highest tested concentration (1 mg/mL). Furthermore, microparticles showed favourable aerodynamic properties for deep lung delivery (MMAD 2.0-3.8 µm) and, thus, show potential for an application as inhalable tuberculosis therapy.info:eu-repo/semantics/publishedVersio

Cytocompatibility and cellular interactions of chondroitin sulfate microparticles designed for inhaled tuberculosis treatment

Tuberculosis remains a leading cause of death, therapeutic failure being mainly due to non-compliance with prolonged treatments, often associated with severe side-effects. New therapeutic strategies are demanded and, considering that the lung is the primary site of infection, direct lung delivery of antibiotics is possibly an effective approach. Therapeutic success in this context depends on suitable carriers that reach the alveoli where Mycobacterium hosts (macrophages) reside, as well as on their ability to promote macrophage capture and intracellular accumulation of drugs. In this work, we propose inhalable polymeric microparticles produced from chondroitin sulfate, a polymer composed by moieties recognized by macrophage receptors. Spray-drying of chondroitin sulfate in combination with two first-line antitubercular drugs (isoniazid and rifabutin) yielded respirable microparticles that evidenced no cytotoxic effects on lung epithelial cells (A549) and macrophages (dTHP1 and J744A.1). The microparticles exhibited tendency for macrophage capture in a dose-dependent manner, which was validated through imaging. High content image analysis revealed that rifabutin induced a dose-dependent increase in phospholipid content of macrophages, which could be prevented by formulation in chondroitin sulfate microparticles. This work provides indications on the potential of chondroitin sulfate carriers to interact with macrophages, thus providing a platform for drug delivery in the context of macrophage intracellular diseases, namely tuberculosis