reChIP-seq reveals widespread bivalency of H3K4me3 and H3K27me3 in CD4+ memory T cells

The combinatorial action of co-localizing chromatin modifications and regulators determines chromatin structure and function. However, identifying co-localizing chromatin features in a high-throughput manner remains a technical challenge. Here we describe a novel reChIP-seq approach and tailored bioinformatic analysis tool, normR that allows for the sequential enrichment and detection of co-localizing DNA-associated proteins in an unbiased and genome-wide manner. We illustrate the utility of the reChIP-seq method and normR by identifying H3K4me3 or H3K27me3 bivalently modified nucleosomes in primary human CD4+ memory T cells. We unravel widespread bivalency at hypomethylated CpG-islands coinciding with inactive promoters of developmental regulators. reChIP-seq additionally uncovered heterogeneous bivalency in the population, which was undetectable by intersecting H3K4me3 and H3K27me3 ChIP- seq tracks. Finally, we provide evidence that bivalency is established and stabilized by an interplay between the genome and epigenome. Our reChIP-seq approach augments conventional ChIP-seq and is broadly applicable to unravel combinatorial modes of action

Control of human adenovirus type 5 gene expression by cellular Daxx/ATRX chromatin-associated complexes

Death domain–associated protein (Daxx) cooperates with X-linked α-thalassaemia retardation syndrome protein (ATRX), a putative member of the sucrose non-fermentable 2 family of ATP-dependent chromatin-remodelling proteins, acting as the core ATPase subunit in this complex, whereas Daxx is the targeting factor, leading to histone deacetylase recruitment, H3.3 deposition and transcriptional repression of cellular promoters. Despite recent findings on the fundamental importance of chromatin modification in host-cell gene regulation, it remains unclear whether adenovirus type 5 (Ad5) transcription is regulated by cellular chromatin remodelling to allow efficient virus gene expression. Here, we focus on the repressive role of the Daxx/ATRX complex during Ad5 replication, which depends on intact protein–protein interaction, as negative regulation could be relieved with a Daxx mutant that is unable to interact with ATRX. To ensure efficient viral replication, Ad5 E1B-55K protein inhibits Daxx and targets ATRX for proteasomal degradation in cooperation with early region 4 open reading frame protein 6 and cellular components of a cullin-dependent E3-ubiquitin ligase. Our studies illustrate the importance and diversity of viral factors antagonizing Daxx/ATRX-mediated repression of viral gene expression and shed new light on the modulation of cellular chromatin remodelling factors by Ad5. We show for the first time that cellular Daxx/ATRX chromatin remodelling complexes play essential roles in Ad gene expression and illustrate the importance of early viral proteins to counteract cellular chromatin remodelling

SPOC1 modulates DNA repair by regulating key determinants of chromatin compaction and DNA damage response

Survival time-associated plant homeodomain (PHD) finger protein in Ovarian Cancer 1 (SPOC1, also known as PHF13) is known to modulate chromatin structure and is essential for testicular stem-cell differentiation. Here we show that SPOC1 is recruited to DNA double-strand breaks (DSBs) in an ATM-dependent manner. Moreover, SPOC1 localizes at endogenous repair foci, including OPT domains and accumulates at large DSB repair foci characteristic for delayed repair at heterochromatic sites. SPOC1 depletion enhances the kinetics of ionizing radiation-induced foci (IRIF) formation after γ-irradiation (γ-IR), non-homologous end-joining (NHEJ) repair activity, and cellular radioresistance, but impairs homologous recombination (HR) repair. Conversely, SPOC1 overexpression delays IRIF formation and γH2AX expansion, reduces NHEJ repair activity and enhances cellular radiosensitivity. SPOC1 mediates dose-dependent changes in chromatin association of DNA compaction factors KAP-1, HP1-α and H3K9 methyltransferases (KMT) GLP, G9A and SETDB1. In addition, SPOC1 interacts with KAP-1 and H3K9 KMTs, inhibits KAP-1 phosphorylation and enhances H3K9 trimethylation. These findings provide the first evidence for a function of SPOC1 in DNA damage response (DDR) and repair. SPOC1 acts as a modulator of repair kinetics and choice of pathways. This involves its dose-dependent effects on DNA damage sensors, repair mediators and key regulators of chromatin structure

SPOC1-Mediated Antiviral Host Cell Response Is Antagonized Early in Human Adenovirus Type 5 Infection

<div><p>Little is known about immediate phases after viral infection and how an incoming viral genome complex counteracts host cell defenses, before the start of viral gene expression. Adenovirus (Ad) serves as an ideal model, since entry and onset of gene expression are rapid and highly efficient, and mechanisms used 24–48 hours post infection to counteract host antiviral and DNA repair factors (e.g. p53, Mre11, Daxx) are well studied. Here, we identify an even earlier host cell target for Ad, the chromatin-associated factor and epigenetic reader, SPOC1, recently found recruited to double strand breaks, and playing a role in DNA damage response. SPOC1 co-localized with viral replication centers in the host cell nucleus, interacted with Ad DNA, and repressed viral gene expression at the transcriptional level. We discovered that this SPOC1-mediated restriction imposed upon Ad growth is relieved by its functional association with the Ad major core protein pVII that enters with the viral genome, followed by E1B-55K/E4orf6-dependent proteasomal degradation of SPOC1. Mimicking removal of SPOC1 in the cell, knock down of this cellular restriction factor using RNAi techniques resulted in significantly increased Ad replication, including enhanced viral gene expression. However, depletion of SPOC1 also reduced the efficiency of E1B-55K transcriptional repression of cellular promoters, with possible implications for viral transformation. Intriguingly, not exclusive to Ad infection, other human pathogenic viruses (HSV-1, HSV-2, HIV-1, and HCV) also depleted SPOC1 in infected cells. Our findings provide a general model for how pathogenic human viruses antagonize intrinsic SPOC1-mediated antiviral responses in their host cells. A better understanding of viral entry and early restrictive functions in host cells should provide new perspectives for developing antiviral agents and therapies. Conversely, for Ad vectors used in gene therapy, counteracting mechanisms eradicating incoming viral DNA would increase Ad vector efficacy and safety for the patient.</p></div

SPOC1 is reduced during Ad infection.

<p>H1299 cells were infected with wild type H5<i>pg</i>4100 at a multiplicity of 50 FFU per cell. Cells were harvested after indicated time points post infection, total-cell extracts were prepared, separated by SDS-PAGE and subjected to immunoblotting. (A) Immunoblotting using mouse monoclonal antibody M73 (E1A), 2A6 (E1B-55K), RSA3 (E4orf6), rat monclonal SPOC1 antibody and mouse monoclonal antibody AC-15 (β-actin) as a loading control. (B) H1299 cells were infected with wildtype (H5<i>pg</i>4100) and mutant viruses (H5<i>pm</i>4149, H5<i>pm</i>4154, H5<i>pm</i>4139) at moi of 50 FFU per cell. Cells were harvested after 48 hours, and immunoblotted using the antibodies above, plus rabbit polyclonal Mre11 antibody.</p

SPOC1 overexpression represses Ad5 gene expression.

<p>(A) To validate the model system, DLD1 or U2OS cells were treated with doxycyclin 12 hours before infection to induce SPOC1 expression; throughout the experiment the cells were grown in media supplied with doxycyclin. Cell extracts were subjected to 10% PAGE and immunoblotting using rat monclonal SPOC1 antibody and mouse monoclonal antibody AC-15 (β-actin) as a loading control. (B) DLD1/U2OS cells were infected with wild type H5<i>pg</i>4100 at a multiplicity of 50 FFU per cell. Viral particles were harvested at the indicated time-points after infection and virus yield was determined by quantitative E2A-72K immunofluorescence staining on HEK293 cells. The results represent the average from three independent experiments and were normalized to values for particle synthesis in SPOC1 induced cells infected with wild type H5<i>pg</i>4100. (C) DLD1/U2OS cells were infected with wild type H5<i>pg</i>4100 at a multiplicity of 50 FFU per cell. Total-cell extracts were prepared at the indicated times post infection. Proteins were separated by 10% SDS-PAGE, and immunoblotted with mouse monoclonal antibody M73 (E1A), 2A6 (E1B-55K), anti-Ad5 rabbit polyclonal serum L133, rat monclonal SPOC1 antibody and mouse monoclonal antibody AC-15 (β-actin) as a loading control. (D) DLD1/U2OS cells were infected with wild type H5<i>pg</i>4100 at a multiplicity of 50 FFU per cell. Total cell extracts were prepared and treated with proteinase K. PCR was performed using E1B-specific primers (E1B-fw 3′-CGC GGG ATC CAT GGA GCG AAG AAA CCC ATC TGA GC-5′; E1B-rev 3′-CGG TGT CTG GTC ATT AAG CTA AAA-5′). The same amounts of PCR product were separated on an analytic agarose gels (1%) and quantification was achieved with the <i>Gene Snap Software</i> (<i>Syngene</i>). The results shown represent the averages from three independent experiments. (E) DLD1/U2OS cells were infected with wild type H5<i>pg</i>4100 at a multiplicity of 50 FFU per cell. 24 h p.i. total RNA was extracted, reverse transcribed and quantified by RT-PCR using primers specific for E1A (E1A fwd: 5′ GTGCCCCATTAAACCAGTTG 3′; E1A rev: 5′ GGCGTTTACAGCTCAAGTCC 3′), E1B-55K (E1B fwd: 5′-GAGGGTAACTCCAGGG TGCG-3′; E1B rev: 5′-TTTCACTAGCATGAAGCAACCACA-3′), hexon (hexon rev: 5′-GAACGGTGTGCGCAGGTA-3′; hexon fwd 5′-CGCTGGACATGACTTTTG AG-3′) and GAPDH (GAPDH fwd:5′-ACCACAGTCCATGCCATCAC-3′ rev:5′-TCCACCACCCTGTTGCTGTA-3′). Data were normalized to 18S rRNA levels (18S rRNA fwd: 5′-CGGCTACCACATCCAAGGAA-3′; 18S rRNA rev: 5′-GCTGGAATTACCGCGGCT-3′). Values correspond to the mean of triplicates and error bars indicate the standard error of the mean.</p

Proteasomal degradation of SPOC1 by the E1B-55K/E4orf6 E3 ubiquitin ligase complex.

<p>(A) H1299 cells were infected with wildtype (H5<i>pg</i>4100) and mutant viruses (H5<i>pm</i>4149, H5<i>pm</i>4154) at moi of 50 FFU per cell. Cells were treated for six hours with proteasome inhibitor (+MG 132), before total-cell extracts were prepared 48 h p.i.. Proteins were separated by SDS-PAGE and subjected to immunoblotting using mouse monoclonal antibody 2A6 (E1B-55K), RSA3 (E4orf6), rat monclonal SPOC1 antibody and mouse monoclonal antibody AC-15 (β-actin) as a loading control. (B) H1299 cells were transfected with pcDNA3-derived plasmids expressing wildtype E1B-55K, E4orf6, or a combination of both. Cells were harvested 48 hours post infection. Total cell extracts were prepared and specific proteins were immunoblotted as described in A.</p

SPOC1 represses viral transcription.

<p>DLD1 or U2OS cells were treated with doxycyclin for 12(A) Transfection with luciferase reporter plasmids under Ad promoter control (E1A, E1B, E2early, MLP). 48 h after transfection, samples were lysed and absolute luciferase activity was measured. All samples were normalized for transfection efficiency by measuring <i>Renilla</i>-luciferase activity. Activity of empty promotor constructs, E1A, E1B, E2early and MLP promoters in non-treated and non-overxpressing cells was normalized to 100%. Mean and STD are from three independent experiments. (B) After infection with H5<i>pg</i>4100 Ad5 wildtype at moi of 20 FFU/cell. 24 hours post infection SPOC1-induced cells were fixed with formaldehyde and analyzed by ChIP assays (see Material and Methods). The average C_t-value was determined from triplicate reactions and normalized against non-specific IgG controls with standard curves for each primer pair. The y-axis indicates the percentage of immunoprecipitated signal from the input ( = 100%). The dotted line highlights values above 1% of input, commonly stated as significant chromatin/protein binding.</p

SPOC1 is efficiently reduced during HSV-1, HSV-2, HIV-1 and HCV infection.

<p>Permissive cells were infected with (A) HSV-1/HSV-2 (HepaRG cells), (B) HIV-1 (PM-1) and (C) HCV (Huh7.5). HIV-1 infected PM-1 cells (16.3% efficiency) were harvested 4.5 weeks p. i.. HepaRG cells infected with HSV-1 (100% efficiency; moi 2.5 PFU/cell) and HepaRG cells infected HSV-2 (50% efficiency; moi 0.1 PFU/cell) were harvested 18 h p. i.. For HCV infection, Huh7.5 cells were first treated with HCV and then selected with blasticidine. Total cell extracts were prepared and proteins were separated by SDS-PAGE and subjected to immunoblotting using mouse monoclonal antibody 2F6 (NS5A/HCV), p24 hybridoma 183-H12-5C, HSV-1/2 anti-nucleocapsid monoclonal antibody and SPOC1 specific rat monoclonal antibody. β-actin was included as a loading control.</p

SPOC1 depletion enhances Ad5 gene expression.

<p>(A) H1299 cells were transfected with siRNA constructs against SPOC1 (si768, 5′-UCA CCU GUC CUG UGC GAA AdTdT-3′) and control siRNA (5′-AGG UAG UGU AAU CGC CUU GdTdT-3′). Cells were harvested at 24 and 48 hours post transfection. Total cell extracts were prepared and proteins were separated by SDS-PAGE and subjected to immunoblotting using SPOC1-specific rat monoclonal ab. β-actin was included as a loading control. (B) H1299 cells were treated with indicated siRNAs to induce SPOC1 depletion and infected 24 hours post transfection with wild type H5<i>pg</i>4100 at a multiplicity of 50 FFU per cell. Viral particles were harvested at the indicated time-points after infection and virus yield was determined by quantitative E2A-72K immunofluorescence staining on HEK293 cells. The results represent the average from three independent experiments. (C) H1299 cells were infected with wild type H5<i>pg</i>4100 at a multiplicity of 50 FFU per cell. Total-cell extracts were prepared at the indicated times post infection. Proteins were separated by 10% SDS-PAGE, and immunoblotted with mouse monoclonal antibody M73 (E1A), 2A6 (E1B-55K), anti-Ad5 rabbit polyclonal serum L133, rat monclonal SPOC1 antibody and mouse monoclonal antibody AC-15 (β-actin) as a loading control. (D) H1299cells were infected with wild type H5<i>pg</i>4100 at a multiplicity of 50 FFU per cell. Total cell extracts were prepared and treated with proteinase K. PCR was performed using E1B-specific primers (E1B-fw 3′-CGC GGG ATC CAT GGA GCG AAG AAA CCC ATC TGA GC-5′; E1B-rev 3′-CGG TGT CTG GTC ATT AAG CTA AAA-5′). The same amounts of PCR product were separated on an analytic agarose gels (1%) and quantification was achieved with the <i>Gene Snap Software</i> (<i>Syngene</i>). The results shown represent the averages from three independent experiments. (E) H1299 cells were infected with wild type H5<i>pg</i>4100 at a multiplicity of 50 FFU per cell. 24 h p.i. total RNA was extracted, reverse transcribed and quantified by RT-PCR using primers specific for E1A (E1A fwd: 5′ GTGCCCCATTAAACCAGTTG 3′; E1A rev: 5′ GGCGTTTACAGCTCAAGTCC 3′), E1B-55K (E1B fwd: 5′-GAGGGTAACTCCAGGG TGCG-3′; E1B rev: 5′-TTTCACTAGCATGAAGCAACCACA-3′), hexon (hexon rev: 5′-GAACGGTGTGCGCAGGTA-3′; hexon fwd 5′-CGCTGGACATGACTTTTGAG-3′) and GAPDH (GAPDH fwd:5′-ACCACAGTCCATGCCATCAC-3′ rev:5′-TCCACCACCCTGTTGCTGTA-3′). Data were normalized to 18S rRNA levels (18S rRNA fwd: 5′-CGGCTACCACATCCAAGGAA-3′; 18S rRNA rev: 5′-GCTGGAATTACCGCGGCT-3′). Values correspond to the mean of triplicates and error bars indicate the standard error of the mean.</p