A Positive Feedback Loop Between Myc and Aerobic Glycolysis Sustains Tumor Growth in a Drosophila Tumor Model

Cancer cells usually exhibit aberrant cell signaling and metabolic reprogramming. However, mechanisms of crosstalk between these processes remain elusive. Here, we show that in an in vivo tumor model expressing oncogenic Drosophila Homeodomain-interacting protein kinase (Hipk), tumor cells display elevated aerobic glycolysis. Mechanistically, elevated Hipk drives transcriptional upregulation of Drosophila Myc (dMyc; MYC in vertebrates) likely through convergence of multiple perturbed signaling cascades. dMyc induces robust expression of pfk2 (encoding 6-Phosphofructo-2-kinase/fructose-2,6-bisphosphatase; PFKFB in vertebrates) among other glycolytic genes. Pfk2 catalyzes the synthesis of fructose-2,6-bisphosphate, which acts as a potent allosteric activator of Phosphofructokinase (Pfk) and thus stimulates glycolysis. Pfk2 and Pfk in turn are required to sustain dMyc protein accumulation post-transcriptionally, establishing a positive feedback loop. Disruption of the loop abrogates tumorous growth. Together, our study demonstrates a reciprocal stimulation of Myc and aerobic glycolysis and identifies the Pfk2-Pfk governed committed step of glycolysis as a metabolic vulnerability during tumorigenesis

Glutaminase Immunoreactivity and Enzyme Activity Is Increased in the Rat Dorsal Root Ganglion Following Peripheral Inflammation

Following inflammation, primary sensory neurons in the dorsal root ganglion (DRG) alter the production of several proteins. Most DRG neurons are glutamatergic, using glutaminase as the enzyme for glutamate production, but little is known about glutaminase following inflammation. In the present study, adjuvant-induced arthritis (AIA) was produced in rats with complete Freund's adjuvant into the hindpaw. At 7 days of AIA, DRG were examined with glutaminase immunohistochemistry, Western blot immunoreactivity, and enzyme activity. Image analysis revealed that glutaminase was elevated most in small-sized neurons (21%) (P < 0.05). Western blot analysis revealed a 19% increase (P < 0.05) in total glutaminase and 21% in mitochondrial glutaminase (P < 0.05). Glutaminase enzyme activity was elevated 29% (P < 0.001) from 2.20 to 2.83 moles/kg/hr. Elevated glutaminase in primary sensory neurons could lead to increased glutamate production in spinal primary afferent terminals contributing to central sensitization or in the peripheral process contributing to peripheral sensitization

Modeling dynamic controls on ice streams: a Bayesian statistical approach

This is the published version, also available here: http://dx.doi.org/10.3189/002214308786570917.Our main goal is to exemplify the study of ice-stream dynamics via Bayesian statistical analysis incorporating physical, though imperfectly known, models using data that are both incomplete and noisy. The physical–statistical models we propose account for these uncertainties in a coherent, hierarchical manner. The initial modeling assumption estimates basal shear stress as equal to driving stress, but subsequently includes a random corrector process to account for model error. The resulting stochastic equation is incorporated into a simple model for surface velocities. Use of Bayes' theorem allows us to make inferences on all unknowns given basal elevation, surface elevation and surface velocity. The result is a posterior distribution of possible values that can be summarized in a number of ways. For example, the posterior mean of the stress field indicates average behavior at any location in the field, and the posterior standard deviations describe associated uncertainties. We analyze data from the 'Northeast Greenland Ice Stream' and illustrate how scientific conclusions may be drawn from our Bayesian analysis

Analysis And Classification Of Multiple Hand Gestures Using MMG Signals

This research aimed to find out whether the MMG signal is useful in recognition of multiple hand gesture.The following hand gestures are Hand closing, wrist flexion, wrist extension,opening,pointing.MMG is reflects the intrinsic mechanical activity of muscle from the lateral oscillations of fibers during contraction.However, external mechanical noise sources such as movement artifact are known to cause considerable interference to MMG compromising the classification accuracy.First aim to develop various feature extraction algorithms software that can identify multiple hand gesture using MMG signal. The main purpose of this work is to identify the hand gestures that are predefined using the artificial neural network,which is particularly useful for classification purpose.The MMG patterns are extracted from the signals for each movement,the features extracted from the signals are given to the neural network for training and classification since it is the good technique for classifying the bio signals.The features like mean absolute value,root mean square,variance,standard deviation and root mean square are chosen to train the neural network

Hand Motion Pattern Recognition Analysis Of Forearm Muscle Using MMG Signals

Surface Mechanomyography (MMG) is the recording of mechanical activity of muscle tissue. MMG measures the mechanical signal (vibration of muscle) that generated from the muscles during contraction or relaxation action. It is widely used in various fields such as medical diagnosis, rehabilitation purpose and engineering applications. The main purpose of this research is to identify the hand gesture movement via VMG sensor (TSD250A) and classify them using Linear Discriminant Analysis (LDA). There are four channels MMG signal placed into adjacent muscles which PL-FCU and ED-ECU. The features used to feed the classifier to determine accuracy are mean absolute value, standard deviation, variance and root mean square. Most of subjects gave similar range of MMG signal of extraction values because of the adjacent muscle. The average accuracy of LDA is approximately 87.50% for the eight subjects. The finding of the result shows, MMG signal of adjacent muscle can affect the classification accuracy of the classifie

Adiponectin Prevents Diabetic Premature Senescence of Endothelial Progenitor Cells and Promotes Endothelial Repair by Suppressing the p38 MAP Kinase/p16INK4A Signaling Pathway

OBJECTIVE - A reduced number of circulating endothelial progenitor cells (EPCs) are casually associated with the cardiovascular complication of diabetes. Adiponectin exerts multiple protective effects against cardiovascular disease, independent of its insulin-sensitizing activity. The objective of this study was to investigate whether adiponectin plays a role in modulating the bioavailability of circulating EPCs and endothelial repair. RESEARCH DESIGN AND METHODS - Adiponectin knockout mice were crossed with db+/- mice to produce db/db diabetic mice without adiponectin. Circulating number of EPCs were analyzed by flow cytometry. Reendothelialization was evaluated by staining with Evans blue after wire-induced carotid injury. RESULTS - In adiponectin knockout mice, the number of circulating EPCs decreased in an age-dependent manner compared with the wild-type controls, and this difference was reversed by the chronic infusion of recombinant adiponectin. In db/db diabetic mice, the lack of adiponectin aggravated the hyperglycemia-induced decrease in circulating EPCs and also diminished the stimulatory effects of the PPARγ agonist rosiglitazone on EPC production and reendothelialization. In EPCs isolated from both human peripheral blood and mouse bone marrow, treatment with adiponectin prevented high glucose-induced premature senescence. At the molecular level, adiponectin decreased high glucose-induced accumulation of intracellular reactive oxygen species and consequently suppressed activation of p38 MAP kinase (MAPK) and expression of the senescence marker p16INK4A. CONCLUSIONS - Adiponectin prevents EPC senescence by inhibiting the ROS/p38 MAPK/p16 INK4A signaling cascade. The protective effects of adiponectin against diabetes vascular complications are attributed in part to its ability to counteract hyperglycemia-mediated decrease in the number of circulating EPCs. © 2010 by the American Diabetes Association.published_or_final_versio

A network analysis to identify pathophysiological pathways distinguishing ischaemic from non-ischaemic heart failure

Aims Heart failure (HF) is frequently caused by an ischaemic event (e.g. myocardial infarction) but might also be caused by a primary disease of the myocardium (cardiomyopathy). In order to identify targeted therapies specific for either ischaemic or non‐ischaemic HF, it is important to better understand differences in underlying molecular mechanisms. Methods and results We performed a biological physical protein–protein interaction network analysis to identify pathophysiological pathways distinguishing ischaemic from non‐ischaemic HF. First, differentially expressed plasma protein biomarkers were identified in 1160 patients enrolled in the BIOSTAT‐CHF study, 715 of whom had ischaemic HF and 445 had non‐ischaemic HF. Second, we constructed an enriched physical protein–protein interaction network, followed by a pathway over‐representation analysis. Finally, we identified key network proteins. Data were validated in an independent HF cohort comprised of 765 ischaemic and 100 non‐ischaemic HF patients. We found 21/92 proteins to be up‐regulated and 2/92 down‐regulated in ischaemic relative to non‐ischaemic HF patients. An enriched network of 18 proteins that were specific for ischaemic heart disease yielded six pathways, which are related to inflammation, endothelial dysfunction superoxide production, coagulation, and atherosclerosis. We identified five key network proteins: acid phosphatase 5, epidermal growth factor receptor, insulin‐like growth factor binding protein‐1, plasminogen activator urokinase receptor, and secreted phosphoprotein 1. Similar results were observed in the independent validation cohort. Conclusions Pathophysiological pathways distinguishing patients with ischaemic HF from those with non‐ischaemic HF were related to inflammation, endothelial dysfunction superoxide production, coagulation, and atherosclerosis. The five key pathway proteins identified are potential treatment targets specifically for patients with ischaemic HF

Enhancement of the recycling and activation of β-adrenergic receptor by Rab4 GTPase in cardiac myocytes,”

Abstract We investigate the role of Rab4, a Ras-like small GTPase coordinating protein transport from the endosome to the plasma membrane, on the recycling and activation of endogenous β-adrenergic receptor (β-AR) in HL-1 cardiac myocytes in vitro and transgenic mouse hearts in vivo. β 1 -AR, the predominant subtype of β-AR in HL-1 cardiac myocytes, was internalized after stimulation with isoproterenol (ISO) and fully recycled at 4 h upon ISO removal. Transient expression of Rab4 markedly facilitated recycling of internalized β-AR to the cell surface and enhanced β-AR signaling as measured by ISO-stimulated cAMP production. Transgenic overexpression of Rab4 in the mouse myocardium significantly increased the number of β-AR in the plasma membrane and augmented cAMP production at the basal level and in response to ISO stimulation. Rab4 overexpression induced concentric cardiac hypertrophy with a moderate increase in ventricle/body weight ratio and posterior wall thickness and a selective up-regulation of the β-myosin heavy chain gene. These data provide the first evidence indicating that Rab4 is a rate-limiting factor for the recycling of endogenous β-AR and augmentation of Rab4-mediated traffic enhances β-AR function in cardiac myocytes. β-Adrenergic receptors (ARs) 2 are members of the seven transmembrane spanning G proteincoupled receptor (GPCR) family and play a critical role in the regulation of cardiac function in response to cate-cholamine stimulation (1-3). Three subtypes, β 1 -AR, β 2 -AR, and β 3 -AR, have been identified in the mammalian hearts. β 1 -AR and β 2 -AR are major mediators of cardiac contractility through coupling to heterotrimeric G proteins to regulate the activation of adenylyl cyclases, which in turn modulates production of intracellular cAMP and activation of protein kinase A. β 1 -AR couples to the stimulatory G protein Gs, whereas β 2 -AR couples to both G s and the inhibitory G protein G i NIH Public Access Rab proteins are Ras-like small GTPases that regulate vesicular protein transport in both endocytosis and exocytosis (6, In this report, we investigated the effect of augmentation of Rab4 function on the recycling and activation of endogenous β-AR in both cardiac myocytes in vitro and mouse hearts in vivo. Our data demonstrated that increased wild-type Rab4 expression facilitated recycling to the plasma membrane and signaling of β-AR in cultured HL-1 cardiac myocytes. Our results also showed that cardiac specific overexpression of wild-type Rab4 augmented the membrane targeting and function of β-AR. Furthermore, overexpression of wild-type Rab4 induced cardiac hypertrophy with preserved contractile function. These data provide the first evidence indicating that endogenous Rab4 expression level is a rate-limiting factor for the recycling of endogenous β-AR and that augmentation of Rab4-mediated traffic enhances β-AR function in cardiac myocytes. EXPERIMENTAL PROCEDURES Materials Antibodies against Rab1, Rab4, Rab5, G s , G i , Gβ, GRK2, and calregulin were purchased from Santa Cruz Biotechnology, Inc. Anti-GM130 antibody was from BD Transduction Laboratories. Antibody against Na + -K + -ATPase was from Affinity Bio-Reagents (Golden, CO Ci/mmol) and [ 3 H]CGP12177 (specific activity = 51 Ci/mmol) were from Amersham Biosciences. All other materials were obtained as described elsewhere Culture and Transfection of HL-1 Cardiomyocytes HL-1 myocytes were plated onto 12-well plates at a density of 4 × 10 5 cells/well and cultured in Claycomb medium supplemented with 10% fetal bovine serum, 100 units/ml penicillin, 100 μg/ml streptomycin, 0.1 mM norepinephrine, and 2 mM L-glutamine as described previously (23). Rab4 was tagged with FLAG epitope at the amino terminus of Rab4 (FLAG-Rab4) by PCR using a primer GACTACAAGGACGACGATGACAAG coding a peptide DYKDDDDK. The FLAG epitope has been used to label a number of proteins resulting in tagged-proteins with similar characteristics to their respective wild-types (24). After 24-h culture without norepinephrine, HL-1 myocytes were transiently transfected with 2 μg of Rab4 or the pcDNA3 vector using Lipofectamine 2000 reagent (Invitrogen) as described previously (23). Ligand Binding in Intact HL-1 Cardiomyocytes Intact cell ligand binding was used to measure cell surface expression of β-AR. HL-1 myocytes were cultured on 12-well plates and incubated with [ 3 H]CGP12177 at a concentration of 20 nM for 2 h at room temperature. To measure the expression of β 1 -AR and β 2 -AR subtypes, the HL-1 cells were preincubated with the β 1 -AR-selective antagonist atenolol (20 μM) or the β 2 -AR-selective antagonist ICI118,551 (20 μM) for 30 min. The nonspecific binding was determined in the presence of alprenolol (20 μM). After washing twice with ice-cold phosphatebuffered saline (1 ml each time), the cells were digested with 1 ml of 1 M NaOH. The radioactivity was counted by liquid scintillation spectrometry in 5 ml of Ecoscint A scintillation solution (National Diagnostics, Inc., Atlanta, GA). Measurement of β-AR Internalization and Recycling in HL-1 Myocytes β-AR internalization in response to stimulation with ISO and recycling of internalized receptors were determined as essentially described (9,12) with modifications. Briefly, HL-1 myocytes were cultured on 12-well plates and transfected as described above. At 48 h after transfection, the cells were incubated with ISO at a concentration of 10 μM for different times at 37 °C to initiate receptor internalization. The cells were washed twice with 1 ml of ice-cold Dulbecco&apos;s modified Eagle&apos;s medium to remove ISO and allowed to recover for different time periods (from 15 to 240 min). β-AR expression at the cell surface was then determined by ligand binding as described above. Generation of Rab4 Transgenic Mice Transgenic mice overexpressing Rab4 in the myocardium were generated essentially as described (21). The cDNA encoding FLAG-Rab4 was cloned into exon three of the full-length mouse α-myosin heavy chain (MHC) promoter (21). The entire 7.7-kb transgene fragment containing the entire α-MHC promoter, the complete FLAG-Rab4 cDNA, and a human growth hormone polyadenylation signal sequence was released from the plasmid backbone by digestion with BamHI and was used for microinjection into pronuclei of fertilized mouse oocytes (FVB/N background) using standard techniques (Pennington Biomedical Research Institute, Louisiana State University, Baton Rouge, LA). Transgenic mice were identified by Southern blot or PCR analysis using genomic DNA extracted from mouse tails. All studies were performed in Rab4 transgenic mice and nontransgenic (NTG) siblings at 22 weeks old in accordance with protocols approved by the Louisiana State University Health Sciences Center Institutional Animal Care and Use Committee. Measurement of Cardiac β-AR Expression β-AR density was measured as described Measurement of cAMP Production cAMP production in response to stimulation with ISO or forskolin was measured in the presence of 3-isobutyl-1-methylxanthine (0.5 mM), a phosphodiesterase inhibitor, by using cAMP enzymeimmunoassay system (Biotrak, Amersham Biosciences) as described (26). For measurement of cAMP production by membrane fractions prepared from NTG and Rab4 transgenic mouse ventricles, an aliquot of membrane fraction (about 0.8 μg of protein) was transferred into microtiter plates and then incubated with anti-cAMP antiserum, followed by the incubation with cAMP-peroxidase. After washing and addition of substrate, peroxidase activity was measured by spectrometry. cAMP concentrations were calculated based on the competition of cAMP in samples with a fixed quantity of peroxidase-labeled cAMP. For measurement of cAMP production in cultured cardiomyocytes, HL-1 cells were cultured in 12-well plates and transfected with 2 μg of Rab4 or pcDNA3 as described above. After 48 h, the cells were stimulated with increasing concentrations of ISO (from 10 −9 to 10 −5 M) or forskolin (100 μM) for 10 min at room temperature. The reactions were stopped by aspirating the medium and then the cells were lysed using 200 μl of dodecyltrimethylammonium (2.5%). One-hundred μl of cell lysate was used to determine cAMP concentration as described above. Measurement of Cardiac Hypertrophy Morphometric analysis and histological examination of Masson&apos;s trichrome-and hematoxylineosin-stained ventricles used standard techniques as described previously (21). Cardiac gene expression was assayed by RNA dot blot analysis using total RNA (3 μg/dot) extracted from ventricles of NTG and transgenic mice and 32 P-labeled oligonucleotides as probes (21,27). Radiolabeled RNA dots were quantitated with a PhosphorImager (Amersham Biosciences), and expression of each cardiac gene was normalized to glyceraldehyde-3-phosphate dehydrogenase expression. Echocardiography Mice were anesthetized with avertin (250 mg/kg, intraperitoneal). Cardiac ultrasound studies were performed on Rab4 transgenic mice and NTG sibling controls at 22 weeks old using a SSA770 Aplio Ultrasound system (Toshiba America Medical Systems, Tustin, CA) with a 1204AX linear array transducer scanning at 14 MHz center frequency. Depth setting was 2 cm with a 0.75-cm electronic focus and two-dimensional imaging frame rate of 238 Hz. Twodimensional guided M-mode studies of the left ventricle at the level of the papillary muscles were performed. M-mode measurements were made using the leading-edge to leading-edge Immunoblot Analysis Western blot analysis of protein expression was carried out as described previously (22,23). Proteins were separated by SDS-PAGE and transferred onto polyvinylidene difluoride membranes. The signal was detected using ECL Reagent Plus (PerkinElmer Life Sciences, Boston, MA) with a Fujifilm Luminescent Image Analyzer (LAS-1000plus) and quantitated using Image Gauge Program (Version 3.4). Protein loading and transfer efficiency were evaluated by Amido Black staining of the membrane after immunoblotting. Statistical Analysis Data are expressed as the mean ± S.E. Differences were evaluated using Student&apos;s t test. p &lt; 0.05 was considered as statistically significant. RESULTS Effect of Transient Expression of Rab4 on the Recycling of Internalized β-AR in HL-1 Cardiomyocytes To determine whether Rab4 is involved in the regulation of endogenous β-AR recycling in cardiac myocytes, we choose HL-1 cardiomyocytes, an immortal cardiac muscle cell line that proliferates and retains phenotypic characteristics of cardiomyocytes Internalization of β-AR in response to stimulation with ISO in HL-1 cardiac myocytes was then characterized. ISO stimulation induced internalization of plasma membrane β-AR in a time-and dose-dependent manner In the next series of experiments we determined whether increased Rab4 function could modulate the recycling of internalized β-AR in HL-1 myocytes. HL-1 myocytes were transiently transfected with FLAG-tagged Rab4. Rab4 expression was then determined by Western blotting using FLAG high affinity monoclonal and Rab4 antibodies. The FLAG antibody detected only exogenously transfected Rab4, whereas the Rab4 antibody detected both transfected FLAG-Rab4 and endogenous Rab4. Rab4 expression was about four times higher in the FLAG-Rab4 transfected cells than endogenous Rab4 in cells transfected with the pcDNA3 vector ( NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript The HL-1 myocytes were treated by ISO for 30 min to initiate internalization and then allowed to recover for various period of time (15, 30, 60, 120, and 240 min). After 4 h, β-ARs were fully recycled back to the plasma membrane in myocytes transfected with the pcDNA3 vector Effect of Transient Expression of Rab4 on β-AR Signaling in HL-1 Cardiomyocytes To determine whether Rab4-faciliated recycling of internalized β-AR could modulate β-AR signaling, we measured the effect of transient expression of Rab4 on cAMP production in HL-1 cardiomyocytes. HL-1 myocytes were stimulated with increasing concentration of ISO (from 10 −9 to 10 −5 M) and intracellular cAMP concentrations were then measured. cAMP production in response to ISO stimulation at concentrations from 10 −8 to 10 −5 M was significantly higher in myocytes transfected with Rab4 than myocytes transfected with the pcDNA3 vector Effect of Transgenic Overexpression of Rab4 on β-AR Expression in the Plasma Membrane Preceding data indicate that increased Rab4 function facilitates recycling of internalized endogenous β-AR in cultured HL-1 myocytes. To determine whether increased Rab4 function could influence β-AR recycling in cardiac myocytes in vivo, we generated transgenic mice cardiac-specifically expressing FLAG-tagged Rab4. Transgenic mice were identified by Southern blot and PCR analyses of genomic DNA extracted from mouse tails. Rab4 expression in the ventricles of Rab4 transgenic and NTG mice was determined by Western blot analysis using anti-Rab4 and FLAG antibodies. Rab4 expression in transgenic mouse ventricles was increased by about 12-fold compared with NTG siblings We next determined whether Rab4 overexpression could alter the density of β-AR in the plasma membrane by radioligand binding. As β-AR are synthesized in the ER and transported to the plasma membrane through the Golgi apparatus, any contamination of the ER and/or the Golgi in the plasma membrane fractions would influence the actual number of the receptors in the plasma membrane. Thus, we first determined whether the plasma membrane preparations contained the ER and/or Golgi by measuring the expression of the ER marker calregulin, the Golgi marker GM130, and the plasma membrane marker Na + -K + -ATPase by immunoblotting. Both calregulin and GM130 were exclusively detected in the cytosolic fraction but not in the membrane fraction, whereas Na + -K + -ATPase was detected in the membrane fraction but not in the cytosolic fraction β-AR density was significantly increased in the membrane fraction from Rab4 transgenic mouse ventricles by 22% NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript β-AR density, expression of G s , G i , Gβ, and GRK2, molecules involved in the β-AR signaling, was not altered in Rab4 transgenic mice Effect of Transgenic Overexpression of Rab4 on β-AR Signaling We then determined whether enhanced Rab4 expression in the plasma membrane in vivo could activate β-AR signaling. cAMP production in response to stimulation with ISO was measured using membrane preparations from Rab4 transgenic and NTG mouse ventricles. Consistent with the increased β-AR density in the plasma membrane, ISO-stimulated cAMP production was significantly augmented by 3.3-fold in ventricles from Rab4 transgenic mice as compared with NTG controls Effect of Transgenic Overexpression of Rab4 on Cardiac Hypertrophy and Function The absolute heart and ventricle weights were significantly increased in Rab4 transgenic mice at 22 weeks old as compared with age-matched NTG controls (heart weight: NTG, 0.15 ± 0.01 and Rab4, 0.18 ± 0.01 g, n = 12, p &lt; 0.05; ventricle weight: NTG, 0.13 ± 0.01 and Rab4, 0.16 ± 0.01 g, n = 12, p &lt; 0.05). There was no difference in body weight between Rab4 transgenic and NTG mice (NTG, 32.4 ± 1.1 and Rab4, 31.2 ± 0.7 g), resulting in an increase in heart and ventricle weight-to-body weight ratio in the Rab4 mice Increased expression of cardiac fetal genes is associated with cardiac hypertrophy. To determine whether Rab4 overexpression-induced cardiac hypertrophy, as reflected by increased cardiac mass, is accompanied by an increased expression of hypertrophy-associated genes, we quantified the expression of atrial netriuretic peptide, β-MHC and α-skeletal actin by RNA dot blot. β-MHC expression normalized to the mRNA expression of glyceraldehyde-3-phosphate dehydrogenase was increased by 3.5-fold in Rab4 transgenic mouse hearts as compared with those from NTG mice In vivo M-mode echocardiography was used to determine the effect of Rab4 overexpression on left ventricular dimension at end-diastole (EDD) and end-systole (ESD) and posterior left ventricular wall thickness at end-diastole. Consistent with morphological and gravimetric data, posterior wall thickness in Rab4 transgenic mice was significantly increased by ~30% DISCUSSION Rab4 GTPase coordinates protein transport from the endosome to the plasma membrane The most important finding in this report is that Rab4 functions as a rate-limiting factor for the transport of endogenous β-AR to the plasma membrane. We first demonstrated that the recycling of β-AR after agonist stimulation was significantly facilitated by transient expression of wild-type Rab4 in HL-1 myocytes, in which β 1 -AR is the predominant subtype. To define whether Rab4 could enhance β-AR recycling in the mouse heart in vivo, we generated transgenic mice overexpressing Rab4 in the myocardium and determined the effect of increased Rab4 expression on the plasma membrane expression of β-AR. Chronic expression of Rab4 in the mouse heart moderately, but significantly, increased the density of β-AR in the plasma membrane. As the same numbers of HL-1 cells were used for transfection with control and Rab4 plasmids and the size of the myocytes from Rab4 transgenic mouse hearts were enlarged, it is likely that the receptor density is increased in each myocyte expressing wild-type Rab4. Rab4 expression did not alter β-AR expression at the cell surface before ISO stimulation and after complete recycling at 4 h, suggesting that Rab4 did not alter total β-AR expression. In contrast to the β-AR, expression of Rab1, Rab5, G s , G i , Gβ, and GRK2 was not affected by Rab4 expression, suggesting that altered Rab4 expression did not influence total protein synthesis. As Rab4 has been well demonstrated to regulate protein transport specifically from the endosomes to the plasma memebrane (6, To determine whether overexpression of Rab4 could regulate β-AR signaling as a consequence of modifying β-AR recycling, we measured ISO-stimulated cAMP production in HL-1 cardiomyocytes and in membrane preparations from Rab4 transgenic and NTG mouse hearts. cAMP production in HL-1 cells in response to stimulation at the highest concentration of ISO (10 −5 M) was doubled compared with the basal level. This increase is similar to the data obtained from human atrial membranes (30). As expected, the increased β-AR density in the plasma membrane led to increase in cAMP production after stimulation with ISO in both cultured myocytes and transgenic mouse hearts overexpressing Rab4. However, Rab4 expression had no effect on the cAMP production in response to forskolin stimulation, suggesting that increased cAMP production in response to ISO by Rab4 expression is not due to the alteration of adenylyl cyclase activity. In addition, Rab4 expression had no effect on the expression of other molecules involved in β-AR signal regulation, including G proteins and Filipeanu et al

Multipotent Embryonic Isl1+ Progenitor Cells Lead to Cardiac, Smooth Muscle, and Endothelial Cell Diversification

SummaryCardiogenesis requires the generation of endothelial, cardiac, and smooth muscle cells, thought to arise from distinct embryonic precursors. We use genetic fate-mapping studies to document that isl1+ precursors from the second heart field can generate each of these diverse cardiovascular cell types in vivo. Utilizing embryonic stem (ES) cells, we clonally amplified a cellular hierarchy of isl1+ cardiovascular progenitors, which resemble the developmental precursors in the embryonic heart. The transcriptional signature of isl1+/Nkx2.5+/flk1+ defines a multipotent cardiovascular progenitor, which can give rise to cells of all three lineages. These studies document a developmental paradigm for cardiogenesis, where muscle and endothelial lineage diversification arises from a single cell-level decision of a multipotent isl1+ cardiovascular progenitor cell (MICP). The discovery of ES cell-derived MICPs suggests a strategy for cardiovascular tissue regeneration via their isolation, renewal, and directed differentiation into specific mature cardiac, pacemaker, smooth muscle, and endothelial cell types

Safety of second-generation drug-eluting stents three years after randomised use in the TWENTE trial

Aims: To assess three-year clinical outcome following randomised use of the second-generation Resolute zotarolimus-eluting stent (ZES) and the XIENCE V everolimus-eluting stent (EES). For Resolute ZES and randomised use, outcome data ≥3 years are relatively scarce. Methods and results: The TWENTE trial examined 1,391 patients with stable angina or non-ST-elevation acute coronary syndromes, of whom 21.6% were diabetics, 70.1% had complex B2 or C lesions and 77.4% had “off-label” indications for DES use. Three-year follow-up data were obtained in 1,381 patients (99.3%; 10 withdrawals). Adverse clinical events were independently adjudicated. The primary endpoint target vessel failure (TVF), a composite of cardiac death, target vessel-related myocardial infarction and clinically indicated target vessel revascularisation, was 12.1% for Resolute ZES and 13.4% for XIENCE V EES (p=0.50). Cardiac death rates were 1.9% vs. 3.5% (p=0.06); the other individual components of TVF also showed no significant between-group differences. The rates of definite-or-probable stent thrombosis (1.4% vs. 1.6%, p=0.82) and very late stent thrombosis (0.6% vs. 0.4%, p=1.0) did not differ between the groups. Conclusions: Three-year follow-up data of patients included in the randomised TWENTE trial demonstrated similar and sustained safety and efficacy of Resolute ZES and XIENCE V EE