Circulating insulin-like growth factor I modulates mood and is a biomarker of vulnerability to stress:from mouse to man

Individual susceptibility to anxiety disorders after maladaptive responses to stress is not well understood. We now report that while exploring stress responses in mice after traumatic brain injury (TBI), a condition associated to stress susceptibility, we observed that the anxiogenic effects of either TBI or exposure to life-threatening experiences (predator) were blocked when both stressors were combined. Because TBI increases the entrance into the brain of serum insulin-like growth factor I (IGF-I), a known modulator of anxiety with a wide range of concentrations in the human population, we then determined whether circulating IGF-I is related to anxiety measures. In mice, anxiety-like responses to predator were inversely related to circulating IGF-I levels. Other indicators of mood regulation such as sensitivity to dexamethasone suppression and expression levels of blood and brain FK506 binding protein 5 (FKBP5), a co-chaperone of the glucocorticoid receptor that regulates its activity, were also associated to circulating IGF-I. Indeed, brain FKBP5 expression in mice was stimulated by IGF-I. In addition, we observed in a large human cohort (n = 2686) a significant relationship between plasma IGF-I and exposure to recent stressful life events, while FKBP5 expression in blood cells was significantly associated to plasma IGF-I levels. Collectively, these data indicate that circulating IGF-I appears to be involved in mood homeostasis across different species. Furthermore, the data in mice allow us to indicate that IGF-I may be acting at least in part by modulating FKBP5 expression

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed

Reverberant Elastography for the Elastic Characterization of Anisotropic Tissues

We derive closed-form solutions for reverberant elastography in anisotropic elastic media by adapting the framework used in electromagnetic theory to treat transverse isotropic materials. Different sample-setup geometries are analyzed, highlighting their relevance for both optical coherence elastography (OCE) and ultrasound elastography (USE). Numerical simulations using finite elements are used to validate the proposed solutions in practical cases. OCE experiments are conducted in ex vivo chicken muscle samples for the characterization of in-plane and out-of-plane shear modulus assuming a transverse isotropic elastic model. Additionally, we obtained a generalized geometry-independent solution for the isotropic media case, thus unifying previous results for reverberant elastography.Comment: 12 pages, 14 figure

Carbon nanotube fibers with martensite and austenite Fe residual catalyst: room temperature ferromagnetism and implications for CVD growth

We report on the room temperature ferromagnetic properties of continuous macroscopic fibers made up of carbon nanotubes grown by floating catalyst chemical vapor deposition. Their ferromagnetic behavior originates from the presence of residual catalyst nanoparticles: martensite with 0.77 wt% C content and FCC Fe. The first is intrinsically ferromagnetic, but the latter only due to severe lattice distortion as a consequence of C supersaturation. The stabilization of martensite and austenite occurs mainly because of the small diameter of the nanoparticles, in the range of 4-20 nm. This is smaller than the embryonic nucleus of the relevant equilibrium phases, but also implies that large C concentrations can build up in FCC Fe before C can be segregated as a stable graphitic nucleus. The room temperature remanence ranges from 10% to 25% and the coercivity from 55 to 300 Oe, depending on the choice of promoter for fiber synthesis (S or Se). Superparamagnetic behavior is only observed in S-grown samples on account of the smaller diameter of residual catalyst particles. The results of this work provide an explanation for the widespread observation of magnetic properties in oxide-free CNT samples produced by catalytic growth under a wide range of synthesis conditions

The Cesàro operator on Korenblum type spaces of analytic functions

[EN] The spectrum of the CesA ro operator , which is always continuous (but never compact) when acting on the classical Korenblum space and other related weighted Fr,chet or (LB) spaces of analytic functions on the open unit disc, is completely determined. It turns out that such spaces are always Schwartz but, with the exception of the Korenblum space, never nuclear. Some consequences concerning the mean ergodicity of are deduced.The research of the first two authors was partially supported by the projects MTM2013-43540-P and MTM2016-76647-P. The second author gratefully acknowledges the support of the Alexander von Humboldt Foundation.Albanese, A.; Bonet Solves, JA.; Ricker, WJ. (2018). The Cesàro operator on Korenblum type spaces of analytic functions. Collectanea mathematica. 69(2):263-281. https://doi.org/10.1007/s13348-017-0205-7S263281692Albanese, A.A., Bonet, J., Ricker, W.J.: Mean ergodic operators in Fréchet spaces. Ann. Acad. Sci. Fenn. Math. 34, 401–436 (2009)Albanese, A.A., Bonet, J., Ricker, W.J.: Montel resolvents and uniformly mean ergodic semigroups of linear operators. Quaest. Math. 36, 253–290 (2013)Albanese, A.A., Bonet, J., Ricker, W.J.: The Cesàro operator in growth Banach spaces of analytic functions. Integral Equ. Oper. Theory 86, 97–112 (2016)Albanese, A.A., Bonet, J., Ricker, W.J.: The Cesàro operator in the Fréchet spaces $$\ell ^{p+}$$ ℓ p + and $$L^{p-}$$ L p - . Glasgow Math. J. 59, 273–287 (2017)Albanese, A.A., Bonet, J., Ricker, W.J.: The Cesàro operator on power series spaces. Stud. Math. doi: 10.4064/sm8590-2-2017Aleman, A.: A class of integral operators on spaces of analytic functions, In: Proceedings of the Winter School in Operator Theory and Complex Analysis, Univ. Málaga Secr. Publ., Málaga, pp. 3–30 (2007)Aleman, A., Constantin, O.: Spectra of integration operators on weighted Bergman spaces. J. Anal. Math. 109, 199–231 (2009)Aleman, A., Peláez, J.A.: Spectra of integration operators and weighted square functions. Indiana Univ. Math. J. 61, 1–19 (2012)Aleman, A., Persson, A.-M.: Resolvent estimates and decomposable extensions of generalized Cesàro operators. J. Funct. Anal. 258, 67–98 (2010)Aleman, A., Siskakis, A.G.: An integral operator on $$H^p$$ H p . Complex Var. Theory Appl. 28, 149–158 (1995)Aleman, A., Siskakis, A.G.: Integration operators on Bergman spaces. Indiana Univ. Math. J. 46, 337–356 (1997)Barrett, D.E.: Duality between $$A^\infty$$ A ∞ and $$A^{- \infty }$$ A - ∞ on domains with nondegenerate corners, Multivariable operator theory (Seattle, WA, 1993), pp. 77–87, Contemporary Math. Vol. 185, Amer. Math. Soc., Providence (1995)Bierstedt, K.D., Bonet, J., Galbis, A.: Weighted spaces of holomorphic functions on bounded domains. Mich. Math. J. 40, 271–297 (1993)Bierstedt, K.D., Bonet, J., Taskinen, J.: Associated weights and spaces of holomorphic functions. Stud. Math. 127, 137–168 (1998)Bierstedt, K.D., Meise, R., Summers, W.H.: A projective description of weighted inductive limits. Trans. Am. Math. Soc. 272, 107–160 (1982)Bierstedt, K.D., Summers, W.H.: Biduals of weighted Banach spaces of analytic functions. J. Aust. Math. Soc. (Ser. A) 54, 70–79 (1993)Bonet, J., Domański, P., Lindström, M., Taskinen, J.: Composition operators between weighted Banach spaces of analytic functions. J. Aust. Math. Soc. (Ser. A) 64, 101–118 (1998)Diestel, J., Jarchow, H., Tonge, A.: Absolutely Summing Operators. Cambridge University Press, Cambridge (1995)Domenig, T.: Composition operators on weighted Bergman spaces and Hardy spaces. Atomic Decompositions and Diagonal Operators, Ph.D. Thesis, University of Zürich (1997). [Zbl 0909.47025]Domenig, T.: Composition operators belonging to operator ideals. J. Math. Anal. Appl. 237, 327–349 (1999)Dunford, N., Schwartz, J.T.: Linear Operators I: General Theory. 2nd Printing. Wiley Interscience Publ., New York (1964)Edwards, R.E.: Functional Analysis. Theory and Applications. Holt, Rinehart and Winston, New York, Chicago San Francisco (1965)Grothendieck, A.: Topological Vector Spaces. Gordon and Breach, London (1973)Hedenmalm, H., Korenblum, B., Zhu, K.: Theory of Bergman Spaces. Graduate Texts in Mathematics, vol. 199. Springer, New York (2000)Jarchow, H.: Locally Convex Spaces. Teubner, Stuttgart (1981)Korenblum, B.: An extension of the Nevanlinna theory. Acta Math. 135, 187–219 (1975)Krengel, U.: Ergodic Theorems. de Gruyter Studies in Mathematics, vol. 6. Walter de Gruyter Co., Berlin (1985)Lusky, W.: On the isomorphism classes of weighted spaces of harmonic and holomorphic functions. Stud. Math. 175(1), 19–40 (2006)Meise, R., Vogt, D.: Introduction to Functional Analysis. Clarendon Press, Oxford (1997)Melikhov, S.N.: (DFS )-spaces of holomorphic functions invariant under differentiation. J. Math. Anal. Appl. 297, 577–586 (2004)Persson, A.-M.: On the spectrum of the Cesàro operator on spaces of analytic functions. J. Math. Anal Appl. 340, 1180–1203 (2008)Pietsch, A.: Nuclear Locally Convex Spaces. Springer, Berlin (1972)Shields, A.L., Williams, D.L.: Bounded projections, duality and multipliers in spaces of analytic functions. Trans. Am. Math. Soc. 162, 287–302 (1971)Siskakis, A.: Volterra operators on spaces of analytic functions—a survey. In: Proceedings of the First Advanced Course in Operator Theory and Complex Analysis, Univ. Sevilla Serc. Publ., Seville, pp. 51–68 (2006

XSHOOTER spectroscopy of the enigmatic planetary nebula Lin49 in the Small Magellanic Cloud

We performed a detailed spectroscopic analysis of the fullerene C60-containing planetary nebula (PN) Lin49 in the Small Magellanic Cloud (SMC) using XSHOOTER at the European Southern Observatory Very Large Telescope and the Spitzer/Infrared Spectrograph instruments. We derived nebular abundances for nine elements. We used TLUSTY to derive photospheric parameters for the central star. Lin49 is C-rich and metal-deficient PN (Z ∼ 0.0006). The nebular abundances are in good agreement with asymptotic giant branch nucleosynthesis models for stars with initial mass 1.25 M⊙ and metallicity Z = 0.001. Using the TLUSTY synthetic spectrum of the central star to define the heating and ionizing source, we constructed the photoionization model with CLOUDY that matches the observed spectral energy distribution (SED) and the line fluxes in the UV to far-IR wavelength ranges simultaneously. We could not fit the ∼1–5 μm SED using a model with 0.005–0.1-μm-sized graphite grains and a constant hydrogen density shell owing to the prominent near-IR excess, while at other wavelengths the model fits the observed values reasonably well. We argue that the near-IR excess might indicate either (1) the presence of very small particles in the form of small carbon clusters, small graphite sheets, or fullerene precursors, or (2) the presence of a high-density structure surrounding the central star. We found that SMC C60 PNe show a near-IR excess component to lesser or greater degree. This suggests that these C60 PNe might maintain a structure nearby their central star