THE BRITISH OPT-OUT FROM THE EUROPEAN MONETARY UNION: EMPIRICAL EVIDENCE FROM MONETARY POLICY RULES

We analyze the current state of the monetary integration in Europe focusing on the UK position regarding the European Monetary Union. The interest rates decisions of the European Central Bank and the Bank of England are compared through different specifications of the Taylor Rule. The comparison of the monetary conducts provides a useful feedback when looking for the differences claimed by the British government as motivating the UK refusal to join the European Monetary Union. Testing for a forward looking behavior and possible asymmetries in the policy responses, we show evidence supporting the opt-out by the UK monetary authorities.Taylor rule; European monetary integration; Regime switching models; Interest rate smoothing.

Fluid transfer and vein thickness distribution in high and low temperature hydrothermal systems at shallow crustal level in southern Tuscany (Italy)

Geometric analysis of vein systems hosted in upper crustal rocks and developed in high and low temperature hydrothermal systems is presented. The high temperature hydrothermal system consists of tourmaline-rich veins hosted within the contact aureole of the upper Miocene Porto Azzurro pluton in the eastern Elba Island. The low temperature hydrothermal system consists of calcite-rich veins hosted within the Oligocene sandstones of the Tuscan Nappe, exposed along the coast in southern Tuscany. Vein thickness distribution is here used as proxy for inferring some hydraulic properties (transmissivity) of the fluid circulation at the time of veins’ formation. We derive estimations of average thickness of veins by using the observed distributions. In the case of power law thickness distributions, the lower the scaling exponent of the distribution the higher the overall transmissivity. Indeed, power law distributions characterized by high scaling exponents have transmissivity three order of magnitude lower than negative exponential thickness distribution. Simple observations of vein thickness may thus provides some clues on the transmissivity in hydrothermal systems

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations

Reducción de los descartes en la pesca con trasmallo: resultados experimentales utilizando trasmallo con “faldón” en la pesca artesanal del camarón, Penaeus kerathurus, en el mar Ligur (Mediterráneo Occidental)

This study aimed to test the effectiveness of a “guarding net”, a device placed at the bottom of a trammel net, for reducing unwanted catches in the caramote prawn trammel net fishery of the Ligurian Sea. This specialized and profitable fishery is affected by unwanted catches that generate high discard rates and damage to the nets, with environmental impacts and costs for fishermen. The experimental study consisted in comparing the catches of a standard trammel net (STN) with those of two “experimental” trammel nets, e.g. STNs provided with a guarding net of 19 cm (TGN20) and 24 cm height (TGN25), respectively. The guarding net, a strip of gillnet placed at the bottom of the net, can be considered a by-catch reducer device (BRD). Some fishermen of the investigated fishery have been using this device for several years. The results of the 15 experimental fishing trials performed from June to July 2016 indicate that the guarding nets significantly reduce discards (e.g. crabs and other invertebrates); the biomass of the unwanted species caught was 75% lower than that produced by the STN. The catch rates of the target species obtained with TGN20 and TGN25 were also significantly lower than those of the STN, though of a lesser amount. Nonetheless, this economic loss can be compensated by the decrease in sorting time and material and labour costs that can be achieved using the guarding net.El objetivo de este trabajo fue testar los efectos de un “faldón”, una red colocada en la parte inferior de un trasmallo, para reducir los descartes en la pesquería del camarón del mar Ligur. Se trata de una pesquería especializada y rentable, afectada por capturas no deseadas, que generan descartes y daños a las redes, con impacto ambiental y costes para los pescadores. Se llevaron a cabo pescas experimentales, para comparar la captura de un trasmallo estándar (STN) con la de dos trasmallos “experimentales”, construidos a partir de un trasmallo estándar, con el ajuste de un faldón de 19 cm de altura (TGN20), y de un faldón de 24 cm (TGN25). Este faldón, una banda de red de enmalle, se puede considerar como un dispositivo reductor de capturas accesorias (BRD). Algunos pescadores de la pesquería investigada ya utilizan este dispositivo desde hace algunos años. Los resultados de las quince pruebas experimentales, realizadas de junio a julio 2016, muestran que el faldón de red de enmalle contribuye significativamente a reducir los descartes (cangrejos y otros invertebrados), con una reducción de la biomasa de las especies descartadas hasta el 75%, respecto al trasmallo estándar. Al mismo tiempo, también las tasas de captura de las especies objetivo obtenidas con TGN20 y TGN25 fueron significativamente más bajas que las del STN, aunque de menor magnitud. Sin embargo, esta pérdida económica puede ser compensada por la disminución del tiempo de trabajo, de los costes del material y de la mano de obra, que se pueden lograr utilizando un trasmallo con “faldón”

Preservation, Characterization and Exploitation of Microbial Biodiversity: The Perspective of the Italian Network of Culture Collections

Microorganisms represent most of the biodiversity of living organisms in every ecological habitat. They have profound effects on the functioning of any ecosystem, and therefore on the health of our planet and of human beings. Moreover, microorganisms are the main protagonists in food, medical and biotech industries, and have several environmental applications. Accordingly, the characterization and preservation of microbial biodiversity are essential not only for the maintenance of natural ecosystems but also for research purposes and biotechnological exploitation. In this context, culture collections (CCs) and microbial biological resource centres (mBRCs) are crucial for the safeguarding and circulation of biological resources, as well as for the progress of life sciences. This review deals with the expertise and services of CCs, in particular concerning preservation and characterization of microbial resources, by pointing to the advanced approaches applied to investigate a huge reservoir of microorganisms. Data sharing and web services as well as the tight interconnection between CCs and the biotechnological industry are highlighted. In addition, guidelines and regulations related to quality management systems (QMSs), biosafety and biosecurity issues are discussed according to the perspectives of CCs and mBRCs

Neurological Disorders in Takotsubo Syndrome: Clinical Phenotypes and Outcomes

Background: Neurological disorders as a risk factor for Takotsubo syndrome (TTS) are not well characterized. The aim of the study was to evaluate TTS-associated neurological phenotypes and outcome. Methods and results: Patients with TTS enrolled in the international multicenter GEIST (German Italian Spanish Takotsubo) registry were analyzed. Prevalence, clinical characteristics, and short- and long-term outcomes of patients with TTS were recorded. A subgroup analysis of the 5 most represented neurological disorders was performed. In total, 400 (17%) of 2301 patients had neurological disorders. The most represented neurological conditions were previous cerebrovascular events (39%), followed by neurodegenerative disorders (30.7%), migraine (10%), epilepsy (9.5%), and brain tumors (5%). During hospitalization, patients with neurological disorders had longer in-hospital stay (8 [interquartile range, 5-12] versus 6 [interquartile range, 5-9] days; P<0.01) and more often experienced in-hospital complications (27% versus 16%; P=0.01) mainly driven by cardiogenic shock and in-hospital death (12% versus 7.6% and 6.5% versus 2.8%, respectively; both P<0.01). Survival analysis showed a higher mortality rate in neurological patients both at 60 days and long-term (8.8% versus 3.4% and 23.5% versus 10.1%, respectively; both P<0.01). Neurological disorder was an independent predictor of both the 60-day and long-term mortality rate (odds ratio, 1.78 [95% CI, 1.07-2.97]; P=0.02; hazard ratio, 1.72 [95% CI, 1.33-2.22]; both P<0.001). Patients with neurodegenerative disorders had the worst prognosis among the neurological disease subgroups, whereas patients with TTS with migraine had a favorable prognosis (long-term mortality rates, 29.2% and 9.7%, respectively). Conclusions: Neurological disorders identify a high-risk TTS subgroup for enhanced short- and long-term mortality rate. Careful recognition of neurological disorders and phenotype is therefore needed

Distribution of Exonic Variants in Glycogen Synthesis and Catabolism Genes in Late Onset Pompe Disease (LOPD)

Pompe disease (PD) is a monogenic autosomal recessive disorder caused by biallelic pathogenic variants of the GAA gene encoding lysosomal alpha-glucosidase; its loss causes glycogen storage in lysosomes, mainly in the muscular tissue. The genotype-phenotype correlation has been extensively discussed, and caution is recommended when interpreting the clinical significance of any mutation in a single patient. As there is no evidence that environmental factors can modulate the phenotype, the observed clinical variability in PD suggests that genetic variants other than pathogenic GAA mutations influence the mechanisms of muscle damage/repair and the overall clinical picture. Genes encoding proteins involved in glycogen synthesis and catabolism may represent excellent candidates as phenotypic modifiers of PD. The genes analyzed for glycogen synthesis included UGP2, glycogenin (GYG1-muscle, GYG2, and other tissues), glycogen synthase (GYS1-muscle and GYS2-liver), GBE1, EPM2A, NHLRC1, GSK3A, and GSK3B. The only enzyme involved in glycogen catabolism in lysosomes is alpha-glucosidase, which is encoded by GAA, while two cytoplasmic enzymes, phosphorylase (PYGB-brain, PGL-liver, and PYGM-muscle) and glycogen debranching (AGL) are needed to obtain glucose 1-phosphate or free glucose. Here, we report the potentially relevant variants in genes related to glycogen synthesis and catabolism, identified by whole exome sequencing in a group of 30 patients with late-onset Pompe disease (LOPD). In our exploratory analysis, we observed a reduced number of variants in the genes expressed in muscles versus the genes expressed in other tissues, but we did not find a single variant that strongly affected the phenotype. From our work, it also appears that the current clinical scores used in LOPD do not describe muscle impairment with enough qualitative/quantitative details to correlate it with genes that, even with a slightly reduced function due to genetic variants, impact the phenotype

Clinical-Genetic Features Influencing Disability in Spastic Paraplegia Type 4: A Cross-sectional Study by the Italian DAISY Network

Background and objectives: Hereditary spastic paraplegias (HSPs) are a group of inherited rare neurologic disorders characterized by length-dependent degeneration of the corticospinal tracts and dorsal columns, whose prominent clinical feature is represented by spastic gait. Spastic paraplegia type 4 (SPG4, SPAST-HSP) is the most common form. We present both clinical and molecular findings of a large cohort of patients, with the aim of (1) defining the clinical spectrum of SPAST-HSP in Italy; (2) describing their molecular features; and (3) assessing genotype-phenotype correlations to identify features associated with worse disability. Methods: A cross-sectional retrospective study with molecular and clinical data collected in an anonymized database was performed. Results: A total of 723 Italian patients with SPAST-HSP (58% men) from 316 families, with a median age at onset of 35 years, were included. Penetrance was 97.8%, with men showing higher Spastic Paraplegia Rating Scale (SPRS) scores (19.67 ± 12.58 vs 16.15 ± 12.61, p = 0.009). In 26.6% of patients with SPAST-HSP, we observed a complicated phenotype, mainly including intellectual disability (8%), polyneuropathy (6.7%), and cognitive decline (6.5%). Late-onset cases seemed to progress more rapidly, and patients with a longer disease course displayed a more severe neurologic disability, with higher SPATAX (3.61 ± 1.46 vs 2.71 ± 1.20, p < 0.001) and SPRS scores (22.63 ± 11.81 vs 12.40 ± 8.83, p < 0.001). Overall, 186 different variants in the SPAST gene were recorded, of which 48 were novel. Patients with SPAST-HSP harboring missense variants displayed intellectual disability (14.5% vs 4.4%, p < 0.001) more frequently, whereas patients with truncating variants presented more commonly cognitive decline (9.7% vs 2.6%, p = 0.001), cerebral atrophy (11.2% vs 3.4%, p = 0.003), lower limb spasticity (61.5% vs 44.5%), urinary symptoms (50.0% vs 31.3%, p < 0.001), and sensorimotor polyneuropathy (11.1% vs 1.1%, p < 0.001). Increasing disease duration (DD) and abnormal motor evoked potentials (MEPs) were also associated with increased likelihood of worse disability (SPATAX score>3). Discussion: The SPAST-HSP phenotypic spectrum in Italian patients confirms a predominantly pure form of HSP with mild-to-moderate disability in 75% of cases, and slight prevalence of men, who appeared more severely affected. Early-onset cases with intellectual disability were more frequent among patients carrying missense SPAST variants, whereas patients with truncating variants showed a more complicated disease. Both longer DD and altered MEPs are associated with worse disability