Influence of Academic Self-Efficacy on the Early Academic Success of Underrepresented Minority Nursing Students Enrolled in the First Semester of a Baccalaureate Nursing Program

The identification of reliable predictors of early academic achievement is imperative for the retention and graduation of all nursing students, and particularly underrepresented minority (URM) students. Students with a high sense of academic self-efficacy exhibit greater persistence and interest in their academic performance, a premise that led to this investigation of self-efficacy as a variable affecting early academic success among baccalaureate nursing students. The purpose of this study was to (a) to determine if a significant relationship existed between academic self-efficacy and successful progression for first semester baccalaureate nursing students in general and URM students specifically, (b) determine the predictive ability of academic self-efficacy on progression, and (c) determine if ethnicity moderates the predictive effect of self-efficacy. Self-efficacy theory, which is grounded in social cognitive theory, was the framework for this study. A cross-sectional, descriptive research design was employed utilizing the College Academic Self-Efficacy Survey (CASES). Correlational analysis and logistic regression were conducted to test the hypotheses. Demographic variables were analyzed regarding their relationship to academic self-efficacy. Although statistical analysis did not support any of the proposed hypotheses, a statistically significant relationship was demonstrated between academic self-efficacy and overall GPA, which, for this population, may have implications for retention. Age and transferring from a four-year institution were significant predictors of progression for this population. Although this study was limited by its lack of generalizability and small sample size, further research related to the effects of academic self-efficacy on academic success are warrante

Population Biology Of A Coastal Dune-Dwelling Spider (Arctosa Sanctaerosae) Along The Hurricane Disturbed Northern Gulf Of Mexico Coast

With the continued increase in the number of tourists visiting the Northern Gulf coast in the last century and the resulting development of this coastline the habitat of Arctosa sanctaerosae has become fragmented; and the sprawl of large cities along the coast has further degraded available habitat. In addition to anthropogenic disturbance to this coastal region, hurricanes are an additional and natural perturbation to the ecosystem. This habitat has seen a number of major tropical storms over the last decade and I have sought to explore the impact of habitat destruction and storm-induced disturbance on a species of spider endemic to the coastal dunes of the Northern Gulf Coast. Arctosa sanctaerosae, family Lycosidae, is a wolf spider endemic to the secondary dunes of the white sandy beaches of the Northern Gulf of Mexico. The data presented here explore the status of populations of this species spanning the entire known range and the factors influencing population demography. These findings demonstrate the significant impact of storms on both disturbed and undisturbed habitat and reveal factors influencing the recovery of the spiders, relating this to ecological factors including the height of the dunes and density of vegetation before and following hurricanes Ivan and Katrina. These results reveal habitat characteristics that appear to play a large role in population persistence and components of human disturbance of habitat that have the greatest impact on populations of spiders. Using microsatellite markers I characterize the current structure of the subpopulations of Arctosa sanctaerosae, and current and historical patterns of interpopulation migration. Contemporary modeling methods compare current and historical levels of gene flow and document the decline in migration due to habitat fragmentation. Since the introduction of dense human development along the Northern Gulf of Mexico Coast, Arctosa sanctaerosae has seen what appears to have been a single, contiguous population subdivided and the isolates reduced in size. These results point to the need for further exploration of the status and continued monitoring of the species

Zen and the Samurai: Rethinking Ties Between Zen and the Warrior

The purpose of this study is to examine the supposed ties between the samurai warrior of Japan and the Zen school of Buddhism. It has been suggested by numerous authors that Zen served as the foundation of warrior training methods and ethical codes. This study suggests that the relationship between warrior and Zen has been overstated, and the image of the Zen warrior was largely a product of intense nationalism that dominated Japanese political and religious institutions during the late nineteenth and early twentieth centuries

Product Quality Analysis of Pencil Skirts: How Does Production Affect the Garment?

Madison Hataway is an undergraduate student in the School of Human Ecology at Louisiana Tech University. Julia Morrison is an undergraduate student in the School of Human Ecology at Louisiana Tech University. Sadie McGill is an undergraduate student in the School of Human Ecology at Louisiana Tech University. Kathleen Heiden is an Associate Professor in the School of Human Ecology at Louisiana Tech University

Value based management

Discusses the compatibility of value based management and traditional police personnel practices

Textile Properties of Pencil Skirts: Does Price Matter?

Madison Hataway is an undergraduate student in the School of Human Ecology at Louisiana Tech University. Julia Morrison is an undergraduate student in the School of Human Ecology at Louisiana Tech University. Sadie McGill is an undergraduate student in the School of Human Ecology at Louisiana Tech University. Kathleen Heiden is an Associate Professor in the School of Human Ecology at Louisiana Tech University

Development of 10 microsatellite loci in the wolf spider Arctosa sancterosae (Araneae: Lycosidae)

Abstract Ten novel microsatellite loci were isolated from Arctosa sancterosae, a white dune dwelling species of wolf spider. Diversity was assessed in 273 individuals sampled from 11 populations along the Northern coast of the Gulf of Mexico. These new genetic markers will be useful for the description and conservation of these limited populations. Keywords Arachnids Á Coastal dune ecosystem Á Microsatellites Á Enriched library The white beach spider, Arctosa sancterosae, is a burrowing wolf spider endemic to the dune ecosystem of the northern coast of the Gulf of Mexico (NGC). Species endemic to this ecosystem are ideal for examining the effects of disturbance (e.g. hurricanes, habitat fragmentation/degradation) on population persistence. It is widely recognized that the primary threat to these populations is habitat fragmentation, but with the reduced gene flow associated with anthropogenic habitat modification and a predicted increase in the intensity of tropical storms We developed 10 novel microsatellite loci using the enrichment protocol of Glenn and Schable 2005. Whole genomic DNA was extracted from the legs of A. sancterosae using the DNeasy Tissue Kit (Qiagen) according to the manufacturer's instructions. DNA concentration was determined using a spectrophotometer and genomic DNA was then digested with the restriction enzymes RsaI and XmnI to yield fragments between 300 and 1,000 bp long. To the ends of these fragments we then ligated SuperSNX24 linkers (F; GTTTAAGG CCTAGCTAGCAGAATC, R; GATTCT GCTAGCTAGGCCTTAAACAAAA) and a polymerase chain reaction was performed to ensure ligation was successful. Genomic fragments were enriched using a probe mix containing four biotinylated oligonucleotides (AAT 10 , AAAT 7 , AAC 6 and AGAT 8 ) and separated with streptavidin magnetic beads. This mixture was washed with a 29 SSC, 0.1% SDS solution twice and a 19 SSC, 0.1% SDS solution four times. A magnetic particle collector was used between washes to capture the magnetic beads. After the last wash, fragments were removed from the probes by denaturing at 95°C for 5 min and precipitating with 95% ethanol and 3 M sodium acetate. These fragments were then air-dried and resuspended in 25 lL of TLE. To increase the quantity of these recovered enriched DNA we amplified the enriched pool by PCR using the SuperSNX24-F primer. These amplified fragments were then transformed and cloned using a TOPO TA Cloning Kit (45-0641). Blue-white selection revealed 288 clones that were then screened for inserts suitable (large enough) for microsatellite development by PCR using M13 forward and reverse primer