Abstract Ten novel microsatellite loci were isolated from Arctosa sancterosae, a white dune dwelling species of wolf spider. Diversity was assessed in 273 individuals sampled from 11 populations along the Northern coast of the Gulf of Mexico. These new genetic markers will be useful for the description and conservation of these limited populations. Keywords Arachnids Á Coastal dune ecosystem Á Microsatellites Á Enriched library The white beach spider, Arctosa sancterosae, is a burrowing wolf spider endemic to the dune ecosystem of the northern coast of the Gulf of Mexico (NGC). Species endemic to this ecosystem are ideal for examining the effects of disturbance (e.g. hurricanes, habitat fragmentation/degradation) on population persistence. It is widely recognized that the primary threat to these populations is habitat fragmentation, but with the reduced gene flow associated with anthropogenic habitat modification and a predicted increase in the intensity of tropical storms We developed 10 novel microsatellite loci using the enrichment protocol of Glenn and Schable 2005. Whole genomic DNA was extracted from the legs of A. sancterosae using the DNeasy Tissue Kit (Qiagen) according to the manufacturer's instructions. DNA concentration was determined using a spectrophotometer and genomic DNA was then digested with the restriction enzymes RsaI and XmnI to yield fragments between 300 and 1,000 bp long. To the ends of these fragments we then ligated SuperSNX24 linkers (F; GTTTAAGG CCTAGCTAGCAGAATC, R; GATTCT GCTAGCTAGGCCTTAAACAAAA) and a polymerase chain reaction was performed to ensure ligation was successful. Genomic fragments were enriched using a probe mix containing four biotinylated oligonucleotides (AAT 10 , AAAT 7 , AAC 6 and AGAT 8 ) and separated with streptavidin magnetic beads. This mixture was washed with a 29 SSC, 0.1% SDS solution twice and a 19 SSC, 0.1% SDS solution four times. A magnetic particle collector was used between washes to capture the magnetic beads. After the last wash, fragments were removed from the probes by denaturing at 95°C for 5 min and precipitating with 95% ethanol and 3 M sodium acetate. These fragments were then air-dried and resuspended in 25 lL of TLE. To increase the quantity of these recovered enriched DNA we amplified the enriched pool by PCR using the SuperSNX24-F primer. These amplified fragments were then transformed and cloned using a TOPO TA Cloning Kit (45-0641). Blue-white selection revealed 288 clones that were then screened for inserts suitable (large enough) for microsatellite development by PCR using M13 forward and reverse primer
