First Report of Grapevine rupestris stem pitting-associated virus in Wild Grapevines (Vitis vinifera spp. sylvestris) in Tunisia

Wild grapevines (Vitis vinifera spp. sylvestris) grow in the northern part of Tunisia, and can potentially be natural reservoirs of pathogens including viruses. Grapevine Rupestris stem pitting-associated virus (GRSPaV), a member of the genus Foveavirus in the family of Betaflexiviridae. It is present in grapevines worldwide and is associated with rupestris stem pitting (RSP) and grapevine vein necrosis (Meng et al. 2013). The virus has been detected in the pollen of infected grapevines (Rowhani et al. 2000), but its spread through pollen is not confirmed, although it is transmitted by seed from infected mother plants to their progeny (Lima et al. 2006b). In Tunisia, GRSPaV is very common in table grape cultivars (Soltani et al. 2013) but no data are currently available on the presence of viruses in Tunisian wild grapevines, which can play a role in the dissemination of viruses to the cultivated grapevines. To address this knowledge gap, a survey was carried out in the mountain forests of northern Tunisia. Samples of wild grapevines were labeled during the vegetative season and dormant canes from 84 accessions (male and female plants) were collected during winter. All samples were tested by RT-PCR for the presence of GRSPaV using primers RSP-48 (5'- AGCTGGGATTATAAGGGAGGT-3') and RSP-49 (5'- CCAGCCGTTCCACCACTAAT-3') (Lima et al. 2006a) for the amplification of a 331 bp fragment of the coat protein (CP) gene. Results showed that 51% (43/84) of the samples were infected by GRSPaV. In order to confirm the presence of this virus in wild grapevines, two positive samples (VS56 and VS70) were tested by RT-PCR using primers RSP-52 (5'-TGAAGGCTTTAGGGGTTAG-3') and RSP-53 (5'-CTTAACCCAGCCTTGAAAT-3') (Rowhani et al. 2000) to amplify the complete CP. Isolate VS56 was from a male plant in northern Tunisia and isolate VS70 was from a female plant in the northeast of the country. PCR products of these two isolates were cloned and sequenced in both directions. The Tunisian GRSPaV isolates VS56 (LT855232) and VS70 (LT855235) shared 84% nucleotide sequence identity. Isolate VS56 had 85-86% identity with all GRSPaV sequences available in GenBank, whereas VS70 showed 93-99% identities with isolates SK704-A (KX274274) and ORPN12 (FJ943318). To further confirm the presence of GRSPaV in wild grapevines, the same two samples were tested by RT-PCR using primers McK1U (AGGGATTGGCTGTTAGATGTT) and McK1D (CTTCAGGCAACCCCAAAAA) (Nolasco et al. 2000) to amplify a 355 bp fragment of the RNA-dependent RNA polymerase domain. Isolates VS56 (LT906626) and VS70 (LT906636) shared 89% nucleotide sequence identity. Isolate VS56 had 89-94% identity with isolates SK30 (KX274277) and GRSPaV-MG (FR691076) while VS70 showed 94-95% identity with isolates Tannat-Rspav1 (KR528585) and GRSPaV-GG (JQ922417). To our knowledge, this is the first report of GRSPaV in wild grapevines in Tunisia

Real‐time imaging reveals distinct pore scale dynamics during transient and equilibrium subsurface multiphase flow

Many subsurface fluid flows, including the storage of CO2 underground or the production of oil, are transient processes incorporating multiple fluid phases. The fluids are not in equilibrium meaning macroscopic properties such as fluid saturation and pressure vary in space and time. However, these flows are traditionally modeled with equilibrium (or steady-state) flow properties, under the assumption that the pore-scale fluid dynamics are equivalent. In this work, we used fast synchrotron X-ray tomography with 1 s time resolution to image the pore-scale fluid dynamics as the macroscopic flow transitioned to steady state. For nitrogen or decane, and brine injected simultaneously into a porous rock, we observed distinct pore-scale fluid dynamics during transient flow. Transient flow was found to be characterized by intermittent fluid occupancy, whereby flow pathways through the pore space were constantly rearranging. The intermittent fluid occupancy was largest and most frequent when a fluid initially invaded the rock. But as the fluids established an equilibrium the dynamics decreased to either static interfaces between the fluids or small-scale intermittent flow pathways, depending on the capillary number and viscosity ratio. If the fluids were perturbed after an equilibrium was established, by changing the flow rate, the transition to a new equilibrium was quicker than the initial transition. Our observations suggest that transient flows require separate modeling parameters. The time scales required to achieve equilibrium suggest that several meters of an invading plume front will have flow properties controlled by transient pore-scale fluid dynamics

The development of intermittent multiphase fluid flow pathways through a porous rock

storage and natural gas production. However, due to experimental limitations, it has not been possible to identify why intermittency occurs at subsurface conditions and what the implications are for upscaled flow properties such as relative permeability. We address these questions with observations of nitrogen and brine flowing at steady-state through a carbonate rock. We overcome previous imaging limitations with high-speed (1s resolution), synchrotron-based X-ray micro-computed tomography combined with pressure measurements recorded while controlling fluid flux. We observe that intermittent fluid transport allows the non-wetting phase to flow through a more ramified network of pores, which would not be possible with connected pathway flow alone for the same flow rate. The volume of fluid intermittently fluctuating increases with capillary number, with the corresponding expansion of the flow network minimising the role of inertial forces in controlling flow even as the flow rate increases. Intermittent pathway flow sits energetically between laminar and turbulent through connected pathways. While a more ramified flow network favours lowered relative permeability, intermittency is more dissipative than laminar flow through connected pathways, and the relative permeability remains unchanged for low capillary numbers where the pore geometry controls the location of intermittency. However, as the capillary number increases further, the role of pore structure in controlling intermittency decreases which corresponds to an increase in relative permeability. These observations can serve as the basis of a model for the causal links between intermittent fluid flow, fluid distribution throughout the pore space, and the upscaled manifestation in relative permeability

Validation and Accuracy of Synovial Alpha Defensin in a Suburban Academic Center after Implantation as Part of the Workup for Periprosthetic Joint infections

Introduction Periprosthetic joint infection (PJI) is a leading cause of total hip and knee arthroplasty failure. The Musculoskeletal Infection Society (MSIS) criteria for PJI has allowed diagnosis standardization. To increase the MSIS criteria accuracy, synovial fluid biomarkers have been tested. Studies evaluating synovial alpha defensin have reported both sensitivity and specificity up to 100%. In this study, we report our analysis on the use of alpha defensin testing in a suburban academic tertiary referral center. Methods We performed a retrospective analysis of a prospectively collected database of 133 patients tested for PJI over a 6 year period. From 2014, our standard infection evaluation protocol included synovial alpha defensin fluid analysis. Complete testing data was available on 128 patients. Both primary and revision total hip and knee arthroplasty were included. Sensitivity, specificity, positive predictive value (PPV) and negative predictive value (NPV) were calculated using the 2011 MSIS criteria. T-tests were performed for parametric data. Results Synovial testing of alpha defensin for PJI had a 95.00% sensitivity, a 91.67% specificity, a 67.86% PPV and a 99.00% NPV. Positive alpha defensin tests were corelated with positive serum and synovial CRP, synovial WBC count, and synovial polymorphonuclear cell percent. There was no correlation between positive synovial alpha defensin and age, sex, smoking or diabetic status. Conclusion Synovial testing for alpha defensin in an unbiased cohort gives high sensitivity and NPV comparable to published literature. We recommend using synovial alpha defensin testing for suspected PJI cases, as an additional data point to help determine likelihood

Type and extent of trans-disciplinary co-operation to improve food security, health and household environment in low and middle income countries: systematic review

Acknowledgements: We are grateful to Dr Steve Turner and Dr Adam Price for their insightful comments that improved the manuscript. We would like to thank Heather Clark and Bimbola Kalejaiye for their help in data extraction. We are also grateful to Melanie Bickerton and Dr Amudha Poobalan for their systematic review advice.Peer reviewedPublisher PD

Mapping and Assessment of forest Ecosystem and Their Services. Applications and guidance for decision making in the framework of MAES

The aim of this report is to illustrate by means of a series of case studies the implementation of mapping and assessment of forest ecosystem services in different contexts and geographical levels. Methodological aspects, data issues, approaches, limitations, gaps and further steps for improvement are analysed for providing good practices and decision making guidance. The EU initiative on Mapping and Assessment of Ecosystems and their Services (MAES), with the support of all Member States, contributes to improve the knowledge on ecosytem services. MAES is one of the building-block initiatives supporting the EU Biodiversity Strategy to 2000

Factors Associated with Revision Surgery after Internal Fixation of Hip Fractures

Background: Femoral neck fractures are associated with high rates of revision surgery after management with internal fixation. Using data from the Fixation using Alternative Implants for the Treatment of Hip fractures (FAITH) trial evaluating methods of internal fixation in patients with femoral neck fractures, we investigated associations between baseline and surgical factors and the need for revision surgery to promote healing, relieve pain, treat infection or improve function over 24 months postsurgery. Additionally, we investigated factors associated with (1) hardware removal and (2) implant exchange from cancellous screws (CS) or sliding hip screw (SHS) to total hip arthroplasty, hemiarthroplasty, or another internal fixation device. Methods: We identified 15 potential factors a priori that may be associated with revision surgery, 7 with hardware removal, and 14 with implant exchange. We used multivariable Cox proportional hazards analyses in our investigation. Results: Factors associated with increased risk of revision surgery included: female sex, [hazard ratio (HR) 1.79, 95% confidence interval (CI) 1.25-2.50; P = 0.001], higher body mass index (fo