665 research outputs found
Unusual Cause of Chest Pain on Radiograph
Although pneumomediastinum (PM) is a cause of chest pain, which can be diagnosed on a plain chest radiograph, emergency physicians frequently miss the diagnosis. As follows a description of findings of PM on a chest radiograph
First detection of tomato leaf curl New Delhi virus in melon and zucchini squash in southern Italy
In September 2017, severe symptoms and heavy infestations
of aleyrodids were reported on cucurbit crops grown in open
fields at the border between Apulia and Basilicata regions
(southern Italy). In zucchini squash symptoms consisted in
severe curling and brittle fracture of the leaves. Melon plants
showed bright yellow mosaic on leaves and necrotic streaks
along the stems, flower stalks and fruits whereas squash plants
displayed severe yellow mosaic and leaf blade deformation.
Disease incidence in the three crops was close to 100%.
Symptoms resembled those described recently for infections
of tomato leaf curl New Delhi virus (ToLCNDV) (Panno
et al., 2016) and watermelon mosaic virus (WMV) (Finetti-
Sialer et al., 2012). DNA and RNA preparations from two
plants for each species were tested by PCR, respectively, with
primers For-5’CCCTTGTAAAGTGCAGTCCT3’ and Rev-
5’GGATTTGATGCGTGAGTACA3’ for the AV1 gene of
ToLCNDV DNA-A and with primers For-5’AAACTGGG
CAGGGTAGCA3’ and Rev-5’TAACCTGCTGTTAA
YCCCGCG3’ for the WMV coat protein gene. Samples of
melon and zucchini proved positive for ToLCNDV whereas
WMV was detected in squash. No amplification products
were obtained with primers for squash leaf curl virus,
watermelon chlorotic spot virus, cucumber mosaic virus, cucumber
vein yellowing virus and zucchini yellow mosaic virus.
Amplicon identities were confirmed by sequencing.
Those from zucchini and melon showed 100% identity with
ToLCNDV from Spain (KF749224) and Sicily (KU145141)
whereas those from squash were 99% and 94% identical to
WMV from Belgium (KP980663) and Italy (FJ8231229), respectively.
The sequence of a 507 bp fragment of ToLCNDV
was deposited in GenBank under the accession number
MG269826. This is the first report of ToLCNDV in melon
and in the continental part of the Country
The Volumetric Contraction of Dental Gypsum Materials on Setting
Peer Reviewedhttp://deepblue.lib.umich.edu/bitstream/2027.42/67364/2/10.1177_00220345530320030801.pd
ICTV virus taxonomy profile: Bromoviridae
Bromoviridae is a family of plant viruses with tri-segmented, positive-sense, single-stranded RNA genomes of about 8 kb in total. Genomic RNAs are packaged in separate virions that may also contain subgenomic, defective or satellite RNAs. Virions are variable in morphology (spherical or bacilliform) and are transmitted between hosts mechanically, in/on the pollen and non-persistently by insect vectors. Members of the family are responsible for major disease epidemics in fruit, vegetable and fodder crops such as tomato, cucurbits, bananas, fruit trees and alfalfa. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the family Bromoviridae, which is available at www.ictv.global/report/bromoviridae
ICTV Virus Taxonomy Profile: Bromoviridae
[EN] Bromoviridae is a family of plant viruses with tri-segmented, positive-sense, single-stranded RNA genomes of about 8 kb in total. Genomic RNAs are packaged in separate virions that may also contain subgenomic, defective or satellite RNAs. Virions are variable in morphology (spherical or bacilliform) and are transmitted between hosts mechanically, in/on the pollen and non-persistently by insect vectors. Members of the family are responsible for major disease epidemics in fruit, vegetable and fodder crops such as tomato, cucurbits, bananas, fruit trees and alfalfa. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the family Bromoviridae, which is available at www.ictv.global/report/bromoviridae.Production of this summary, the online chapter and associated resources was funded by a grant from the Wellcome Trust (WT108418AIA). Members of the ICTV (10th) Report Consortium are Elliot J. Lefkowitz, Andrew J. Davison, Stuart G. Siddell, Peter Simmonds, Sead Sabanadzovic, Donald B. Smith, Richard J. Orton and F. Murilo Zerbini.Bujarski, J.; Gallitelli, D.; Garcia, F.; Pallás Benet, V.; Palukaitis, P.; Reddy, M.; Wang, A.... (2019). ICTV Virus Taxonomy Profile: Bromoviridae. Journal of General Virology. 100(8):1206-1207. https://doi.org/10.1099/jgv.0.001282S120612071008Pallas, V., Aparicio, F., Herranz, M. C., Sanchez-Navarro, J. A., & Scott, S. W. (2013). The Molecular Biology of Ilarviruses. Advances in Virus Research, 139-181. doi:10.1016/b978-0-12-407698-3.00005-3Hanssen, I. M., & Lapidot, M. (2012). Major Tomato Viruses in the Mediterranean Basin. Viruses and Virus Diseases of Vegetables in the Mediterranean Basin, 31-66. doi:10.1016/b978-0-12-394314-9.00002-6Jacquemond, M. (2012). Cucumber Mosaic Virus. Viruses and Virus Diseases of Vegetables in the Mediterranean Basin, 439-504. doi:10.1016/b978-0-12-394314-9.00013-0Pallas, V., Aparicio, F., Herranz, M. C., Amari, K., Sanchez-Pina, M. A., Myrta, A., & Sanchez-Navarro, J. A. (2012). Ilarviruses of Prunus spp.: A Continued Concern for Fruit Trees. Phytopathology®, 102(12), 1108-1120. doi:10.1094/phyto-02-12-0023-rv
Simulation of shot peening: From process parameters to residual stress fields in a structure
Manufacturing industries perform mechanical surface treatments like shot peening at the end of the manufacturing chain to protect important working parts. This treatment modifies the near surface of the treated part with the introduction of compressive residual stresses due to the repeated impacts of the shot. Then, the treated part exhibits, not only a longer life, but also a better fretting behavior, an improved resistance to corrosion… The objective of the present paper is first to study the relation between the process parameters and the material state (residual stress and plastic variables…) for a complex geometry. Next, a numerical tool is proposed, able to predict this material state in a time frame that is consistent with industrial constraints. The originality of the proposed approach thus consists in the chaining of the different steps. The first step is to choose the process parameters for the shot peening process considering conventional or ultrasonic shot peening and model the shot dynamics for a complex geometry. Once the impact velocity field is known, the objective is to compute the local incompatible plastic deformation field due to the repeated impacts using analytical methods. Then, a finite element model is used to compute the residual and deformation fields in the considered mechanical part. The complete method has been performed on the model of a gear, a mechanical part that is most often shot peened and exhibits a complex geometry
Ovatoxin-a and Palytoxin Accumulation in Seafood in Relation to Ostreopsis cf. ovata Blooms on the French Mediterranean Coast
Dinoflagellates of the genus Ostreopsis are known to cause (often fatal) food poisoning in tropical coastal areas following the accumulation of palytoxin (PLTX) and/or its analogues (PLTX group) in crabs, sea urchins or fish. Ostreopsis spp. occurrence is presently increasing in the northern to north western Mediterranean Sea (Italy, Spain, Greece and France), probably in response to climate change. In France, Ostreopsis. cf. ovata has been associated with toxic events during summer 2006, at Morgiret, off the coast of Marseille, and a specific monitoring has been designed and implemented since 2007. Results from 2008 and 2009 showed that there is a real danger of human poisoning, as these demonstrated bioaccumulation of the PLTX group (PLTX and ovatoxin-a) in both filter-feeding bivalve molluscs (mussels) and herbivorous echinoderms (sea urchins). The total content accumulated in urchins reached 450 µg PLTX eq/kg total flesh (summer 2008). In mussels, the maximum was 230 µg eq PLTX/kg (summer 2009) compared with a maximum of 360 µg found in sea urchins during the same period at the same site. This publication brings together scientific knowledge obtained about the summer development of Ostreopsis spp. in France during 2007, 2008 and 2009
- …