An Investigation on Resistance to Change Tendency of Province Organizations of Ministry of Education (in Konya Sample)

Bu araştırma Milli Eğitim Bakanlığı Taşra Örgütlerinin değişmeye direnme eğilimlerini belirlemek amacı ile yapılmıştır. Araştırmacı tarafından amaca uygun olarak geliştirilen değişime direnç anketi kullanılmıştır. Araştırma, amaca uygunluğu nedeni ile tarama modeli ile yapılmıştır. Araştırmanın çalışma evrenini Konya İli Karatay, Meram, Selçuklu, Akşehir ve Çumra ilçelerindeki ilköğretimde görev yapan yönetici ve öğretmen ile Konya, İl Milli Eğitim Müdürlüğünde görevli ilköğretim müfettişleri oluşturmaktadır. Araştırma örneklemi ise 87 ilköğretim müfettişi, 300 yönetici, 600 öğretmenden meydana gelmektedir.Elde edilen bulgular sonucunda, kadınların erkeklere oranla değişimi bir sorunlar yumağı olarak gördükleri, erkeklerin ise değişime daha istekli davrandıkları söylenebilir. Ayrıca; yöneticilerin ve müfettişlerin değişim sürecinde öğretmenlerin kişisel direnci ile karşılaşıldığı görüşünde oldukları, yöneticilerin yetkilerinin yetersiz olmalarından dolayı gerekli esnek yapıyı gösteremedikleri kanaatinde oldukları ve bütün grupların değişimin her basamağında aktif olarak katılma isteği içinde oldukları söylenebilir. Değişim ve direnç konusunda daha fazla araştırmalar yapılıp, sonuçlarının sistemde uygulanabilir olması sağlanmalıdır. This study was conducted to determine the resistance trends to the change of Rural Offices of Ministry of Education. With this study; it was aimed to determine if there was a significant difference about the resistance trends to the change among directors, teachers and primary education inspectors for Office applications and personal view.The study was conducted by scanning model because it is suitable for the purpose. The working surroundings of the study was composed of primary education inspectors working in the Directorate of Education in Konya, directors and teachers working in the districts of Karatay, Meram, Selçuklu, Akşehir, and Çumra. The sampling of the study was also composed of 87 primary education inspectors, 300 directors, and 600 teachers.As a result of the finding, it can be said that women find the change as problematic but men behaves more willingly to the change. Moreover, it can be stated that directors and inspectors thought teachers had personal resistance to the change period, that directors did not have enough tolerance because of their insufficient authority and that all the groups are willing to participate in every step of the change. The change and resistance and make the results applicable in the system to apply these functions in a short period successfully

ÇOCUKLARIN RESİMLERİNDEKİ AİLEYİ TANILAMA DURUMLARININ DEĞERLENDİRİLMESİ

Çocuklar resim yoluyla bize duygularınıyansıtabilirler ve olaylar hakkındaki his ve düşüncelerini ifade edebilirler. Çocuğun yaptığıresimler onun iç dünyasının aynasıolarak kabul edilmektedir. Bu düşüncelerden yola çıkarak çocuk resmi konusunda pek çok araştırma yapılmıştır. Bu çalışmada; çocuk resminde aile kavramıdeğerlendirilmeye çalışılmıştır. Çalışmaya Türkiye’den Konya İli Meram ve Selçuklu İlçelerinden ilköğretim okullarına devam eden 8-14 yaşarası66 öğrenci ve Almanya’nın Berlin Şehrinde 8-14 yaşarası58 öğrenci olmak üzere toplam 124 öğrenci alınmıştır. Öğrencilere zihinsel boyutu değerlendirmek amacıile Goodenough Harris Adam Çizme Testi uygulanmıştır. Ayrıca öğrencilerden aile kavramınıdeğerlendirmek amacıile birer aile resmi çizmeleri istenmiştir. Çalışmanın sonucunda her iki ülkede yaşayan çocukların cinsiyetine göre resim çizme ve aileyi tanıma durumlarıarasında kızların erkeklerden daha başarılıolduklarıve yaşilerledikçe aileyi tanıma düzeyinin yükseldiği gözlenmiştir. Ayrıca kardeşsayısına göre aileyi tanıma puanlarıfarklılaşmaktadır, okul başarısıyüksek olan öğrencilerin goodenhough harris testinden aldılarıpuan daha yüksek bulunmuştur

A mesenteric cyst presenting as a femoral hernia: a case report

Mesenteric cysts are a rare phenomenon and can be encountered in different regions of the mesentery or in the retroperitoneal region. They are usually asymptomatic but may lead to a variety of symptoms depending on their site. We report a case of a mesenteric cyst presenting as a femoral hernia, which is, to our knowledge, the second case found in the literature. Forty-eight years old female patient presented with a history of pain and swelling in her left inguinal region for six months. Although femoral hernias are rare conditions, mesenteric cysts can protrude inside the femoral canal. In a case of clinical suspicion of such a condition, appropriate imaging should be performed

Learning styles is teaching mathematics and the effect of the activities based on learning preconditions

Doktora Tezi. YÖK Tez Merkezi No: 347487Bu çalışmada, iki temel problem esas alınmıştır. Öncelikle; ilköğretim 5. sınıf matematik öğretiminde Kolb?un öğrenme stili ve ön koşul öğrenmelere dayalı hazırlanan etkinliklerin öğrencilerin matematik dersine yönelik tutumuna, öz yeterlik algısına, matematik kaygısına ve kalıcılığa etkisi araştırılmıştır. İkinci olarak; ilköğretim matematik öğretiminde, ön öğrenme eksikliklerinin giderilerek, Kolb öğrenme stillerine göre hazırlanan etkinliklerin uygulandığı sınıftaki öğrencilerin, etkinliklere ve sürece ilişkin görüşleri tespit edilmiştir. Bu kapsamda araştırmada, nitel ve deneysel yöntem birlikte kullanılmıştır. Araştırmanın çalışma grubunu, 2011-2012 eğitim öğretim yılı, Konya ili Selçuklu ilçesi Ahmet Acar İlköğretim Okulu?nda öğrenimlerine devam eden toplam 75 beşinci sınıf öğrencisinden oluşmaktadır. Seçilen iki şubeden biri deney (n=37), diğeri kontrol (n=38) grubu olarak seçkisiz yolla atanmıştır. Araştırmanın veri toplama araçlarını; Öğrenme Alanı Başarı Testi, Matematik Tutum Ölçeği, Matematik Kaygısı Ölçeği, Matematiğe Karşı Öz Yeterlik Algısı Ölçeği, Kolb Öğrenme Stilleri Envanteri ve Öğrenci Görüşme Formu oluşturmuştur. Araştırmanın nicel boyutunu test etmek amacıyla veriler üzerinde, tek faktörlü ANCOVA ve tek faktör üzerinde tekrarlı ölçümler için tek faktörlü ANOVA (repeated measures) analizler yapılmıştır. Araştırmanın nitel boyutundan elde edilen veriler ise; betimsel istatistiklerle analiz edilmiştir. Araştırma bulgularından elde edilen sonuçlara göre; 1. Öğrencilerin öğrenme stillerine göre; deney grubu öğrencilerinin kontrol grubuna göre tutum, öz yeterlik ve kalıcılık düzeylerinin arttığı, kaygı düzeylerinin ise azaldığı tespit edilmiştir. 2. Ön öğrenme eksikliklerinin giderilmesi ve öğrenme stillerine dayalı hazırlanan etkinlik süreci ile ilgili deney grubu öğrencilerinin, ?dersin işlenişine yönelik?, ?sınıf ortamına yönelik? ve ?matematik öğretimine yönelik? görüşlerinin genel olarak olumlu olduğu tespit edilmiştir.This study is based on two fundamental problems. Firstly; the effect of activities prepared for elementary 5th grades on the basis of Kolb?s learning styles and prerequisite learning skills on students? attitude towards mathematics class, self-efficacy perception, mathematics anxiety and retention was researched. Secondly; the opinions of the experimental group students about the learning process and the activities, with whom the activities based on Kolb?s learning styles were practiced as well as eliminating the prerequisite learning deficiencies, were determined. Within this framework, descriptive and experimental methods were used in this research. The participants of the study were composed of 75 fifth graders who attended Ahmet Acar Elementary School, in Selçuklu, Konya, during 2011-2012 academic year. The two chosen classrooms were assigned as experimental (n=37) and control (n=38) groups randomly. Research?s data collection tools are Learning Domain Success Test, Mathematics Attitude Scale, Mathematics Anxiety Scale, Scale of Self-Efficacy in Mathematics, Kolb Learning Style Inventory and Student Interview Form. With an aim to test the quantitative dimension of the research, single factoral ANCOVA was used on the data, and for repeated measures on single factor, single factoral ANOVA was applied. The data acquired from the research?s quantitative dimension were analyzed by descriptive statistics. According to the results of the study: 1. In view of the students? learning styles, it was found that, when compared with the control group students?, experimental group students? attitude, self-efficacy and permanence levels increased and their anxiety level decreased, . 2. It was determined that the opinions of experimental group students about the activity process based on learning styles and the elimination of prerequisite deficiencies were in general positive towards ?teaching the lesson?, ?classroom environment? and ?teaching mathematics

Investigation of the genus Leptospira in Edirne and surroundings

Bu çalışmada, Edirne’deki çevresel sulardan alınan su numunelerinde ve çevresel sularda yaşayan kurbağalarda Leptospira sp. cinsi bakterilerin varlığı araştırılmıştır. Çevresel sulardan alınan 44 su numunesinde ve 100 kurbağa böbreğinde alınan doku örneklerinde moleküler ve bakteriyolojik yöntemler kullanılarak patojen bakteriler araştırılmıştır. Ayrıca karanlık alan mikroskopisi ile Leptospira sp. cinsi bakteriler saptanmıştır. 5-FU içeren EMJH besiyerinde kültürü yapılan bakteriler giemsa yöntemi ile boyanmıştır. Su numunelerinin membran filtrasyon yöntemi ile çalışılarak hazırlanan kültürlerin karanlık alan mikroskopisi ile değerlendirilmesinde 44 su numunesinin sadece 1’ inde (%2,27) Leptospira spp. tespit edilmiştir. Kurbağa böbreğinden alınan doku örneklerinden yapılan kültürlerin karanlık alan mikroskobunda değerlendirilmesi sonucu 100 adet kurbağa böbreğine ait kültürden 7’sinde (%7) Leptospira spp. tespit edilmiştir. Leptospira spp. tespit edilen toplam 8 kültürden hazırlanan preperatlar Giemsa yöntemi ile boyanarak spiroketler ışık mikroskobu ile görüntülenmiştir. Leptospira tespit edilen 8 adet kültürden izole edilen DNA’lar sec Y (preprotein translocase for Leptospira) proteinini kodlayan gen bölgesine ait primerler (GCGATTCAGTTTAATCCTGC ve GAGTTAGAGCTCAAATCTA) kullanılarak Real-Time PCR ile çoğaltılmıştır. Bu çalışma ile ilk kez Edirne ve çevresindeki sularda ve bu sularda yaşayan kurbağalarda non-patojen, saprofit Leptospira cinsi spiroketlerin varlığı gösterilmiştir.In this study, presence of bacteria of the genus Leptospira were investigated in surface water and frog tissue samples collected from Edirne and surroundings. By using the dark field microscopy, Giemsa staining and by inoculating EHJH medium with 5-FU, presence of Leptospira were investigated. Cultivated bacteria were genotyping by using the RT-PCR technique and species-specific probes to determine the pathogenic Leptospira interrogans complex. As a result, when water samples were prepared by the membrane filtration method and evaluated by dark field microscopy, only 1 'of water samples (2,27%) were contained Leptospira spp. Also cultured frog kidney samples were evaluated in the dark field microscope. Seven (7%) of the frog kidney sampels belonging to the frog kidney were found to be positive for Leptospira. Bacterie were stained from positive cultures by using Giemsa method. DNA sampeles isolated from 8 leptospira cultures were amplified by Real-Time PCR using the gene locus primers (GCGATTCAGTTTAATCCTGC and GAGTTAGAGCTCAAATCTA) encoding the sec-Y (preprotein translocase for Leptospira) protein. Pathogen Leptospira interrogans was not found in the study. First time, in this study, non- patogenic, saprophitic Leptospira genus spirochetes were demonstrated in surface waters and frog tissue samples in Edirne and surrounding