EVA LUASI LAPANGAN VAKSIN NEWCASTLE DISEASE GALUR VG/GA PADA BEBERAPA PETERNAKAN AYAM PEDAGING KOMERSIL DI JAWA

ABSTRACT: Evaluasi lapangan hti bertajuan untuk mengetalini thigkat perlindungan, realusi paseaystkshiasi dan kinerja zooteknik kelompok ayam yang divaksinasi dengan vaksin Newscasde disease (ND) gaiter VG/GA. Penelition ini drialuilian pada 26.000 ekor ayam pedaging yang berasal dari 4 peternakan di beberapa daerah di Jaws, yang mempunyai kondisi manajemen yang bervariasi. Ayam-ayam tersebut divaksinasi dengan vaksin ND gaiur VGIGA dengan/tanpa ND inaktif afaupun dengan vaksin B-1/La Seta denganftanpa ND inaktif. Pemeriksaan serologik dilakukan pada tuner 28 dan 35 hari, sedangkan uji tsmtang dengan virus NI) isolat lokal dilakukan pads umur 45 had. Basil evaluasi lapangan menunjukkan bahwa pada ayam pedaging, vaksin ND VG/GA memberilum perlindungan yang tinggi terbadap uji tantang dengan virus ND hoist lokal (Indonesia) dan herhadap infeksi virus ND lapangan. Analisis stathfik menuujukkan bahwa titer hemaglutinasi inhibisi (HI) terhadap NDV pada kelompok ayam yang divaksinasi dengan Wain ND VG/GA denganitanpa vaksin ND inaktif lebib tinggi secara bermalma (P < 0,05) dibandingkan dengan kelompok yang diberi vaksin B-1/La Seta denganhtanpa ND inaktif. Pada kondisi tertentu, reaksi pascavaksinasi kbih ringan dan kinerja zootelmik lebih balk pada kelompok ayam yang divaksinasi dengan vaksin VG/GA dibandingkan dengan kelompok yang diberi vaksin B-1/La Seta. Kata kunci : Newcastle disease, vaksin, ayam pedaging Key words: Newscastle disease ,broiler, vacein

HUBUNGAN ANTARA AKTIVITAS ASETILKOLINESTERASE SERUM DAN LESI PADA OTAK IKAN MAS YANG DIBERI DIAZINON DALAM AIR AKUARIUM

ABSTRACT: Penelitian ini bertujuan untuk mempelajari hubungan antara aktivitas asetilkolinesterase (AKE) serum dan timbulnya lesi pada otak ikan mas (Cyprinus carpio) yang diberi diazinon. Penelitian ini dilakulcan\u27 pada 32 ekor ikan, yang dibagi menjadi 4 kelompok, masing-masing 8 ekor. Ikan-ikan dalam 3 kelompok diberi diazinon melalui air akuarium dengan dosis nrasingnosing 0,1 ppm, 0,5 ppm dan 1,5 ppm sedangkan sate kelompok lainnya sebagai kontrol tanpa diberi bahan uji. Contoh darah dart 4 ekor ikan pada setiap kelompok diambil pada hart ke- 14 dan ke-28 setelah perlakuan, kemudian ikan dibunuh dan contoh jaringan otak diambil untuk pemeriksaan histopatologik. Analisis statistik dengan metode 2 x 4 factorial ANOVA menunjukkan bahwa aktivitas AKE pada kelompok ikan yang diberi diazinon 0,1 ppm, 0,5 ppm dan 1,5 ppm lebih rendah secara bermakna (P < 0,05) dibandingkan dengan kelompok kontrol pada hart ke- 14 ataupun ke-28 setelah perlakuan. Uji multiple comparison dengan Student Newman Keuls (SNK) tidak menunjukkan adanya perbedaan yang bermakna antara kelompok dosis pada setiap periode pemeriksaan. Secara histopatologik tidak ditemukan adanya lesi tertentu pada otak. Hasil penelitian int memberi petunjuk tentang mekanisme toksisitas diazinon pada ikan mas, don mungkin juga pada ikan secara umum, yang meliputi hambatan pada AKE. Pemberian diazinon dosis rendah hanya menyebabkan penurunan aldivitas ensim tersebut tanpa disertai oleh lesi pada otak

Pengaruh Diet Berkadar Lemak Tinggi terhadap Efek Toksik atau Karsinogenik Inisiator -n-nitrosommetilamin dan Promotor et nil estradiolpada paru Tikus Wistar

Penelitian ini bertujuan untuk nrempelajari pengaruh diet berkadar lemak tinggi dan sumher lemak terhadap efek toksik ataupun karsinogenik N-nitrosodimelilamin (ND /1) dan etinil estradiol (EE) pada paru tikus percobaan. Penelitian ini dilakukan pada 72 ekor tikus betina yang diberi NDMA dan/atau EE serta diberi pakan dengan kadar lemak normal atau lemak 15%, yang mengandung 10% lemak hewani ataupun nabati. Tikus dibunuh pada hari ke-135 setelah promosi, kemudian seluruh paru dimasukkan kedalam .formalin 10% dan contoh jaringan paru diwarnai dengan metode hen:woks-din dan eosin (H & E). Secara nrakroskopik dapat ditemukan adanva noduli pada paru kelompok tikus yang diberi NDM4. ND,V.L4 dan EE atau EE. Penambahan 10% lemak hewani atau nabati dalam diet ternvata mempunyal efek _yang lebih besar untuk meningkatkan jumlah noduli paru dibandingkan dengan diet normal. Sumber lemak ternyata tidak nrempunvai efek yang berbeda terhadap perkembangan noduli pada paru. Secara mikroskopik, noduli pada paru dapat digolongkan sebagai adenoma yang mungkin berasal dari set epithet alveoli. Hasil penelitian lint memberi petunjuk tentang adanva efek _yang lebih besar dari diet .17ang, mengandung tambahan 10% lemak hewani atau nabati terhadap karsinogenesis paru dibandingkan dengan diet normal. Kata kunci : karsinogenikN-nitrosodimetilamin: etinil estradiol: lemaknoduli par

Gambaran Histopatologi Otak Tikus Akibat Injeksi Trimetyltin sebagai Model Penyakit Alzheimer

Trimethyltin chloride (TMT) is an organotin compound which neurotoxic at limbus system and hippocampus in human and animal. Pathology changes that caused by the induction of TMT is a neurodegenerative disorder such as nerve cell death and cognitive impairment. This study was aimed to observe brain pathology induced by TMT with multiple doses for 14, 21 and 28 days after treatment. Twenty seven of Wistar rats, at 2 months of age with weight ranging between 200-300 grams were used and divided randomly into 3 groups (n=9). Group I were injected by trimetyiltin with a dose of 6 mg / kg, group II were injected bytrimetyltin with a dose of 8 mg / kg and group III as control without injection. Observation of brain pathology was done by euthanasia on day 14, 21 and 28 after treatment, three rats each. Cortex and hippocampus of the brainwere observed using Hematoxilin and Eosin staining (HE). All of the research procedure was done with the approval and supervision of Animal Ethics Committee LPPT UGM No. 300/KEC-LPPT/VII/2015. The observation of histopathology of the brain's neuron cells injected by trimetyltin dose of 6 mg/kg and 8 mg/kg body weight was showed increasing cell death of brain neurons in the cortex and hippocampus compared to the control group. The highest cell death was on day 14 in the hippocampus and cortex cerebral on day 21after TMT injection. The neuron cell death characterized by the shrink of brain neurons as well as colored eosinophilic cytoplasm. One way ANOVA statistical analysis showed a significant difference number of neurons cell deathbetween control and treatment groups. Based on this research, it can be concluded that the trimetyltin injection dose of 6 mg / kg and 8 mg / kg of body weight caused neuron cell death in the brain rats from fourteen day aftertreatment, especially in the hippocampus and cortex

Molecular Study on The Pathogenicity of Avian Influenza Virus

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny

Isolasi, Identifikasi, dan Serotyping Avibacterium paragallinarum dari Ayam Petelur Komersial yang Menunjukkan Gejala Snot

Infectious coryza (snot) is one of acute respiratory disease in breeders, layers, and broilers caused by Avibacterium paragallinarum (Av. paragallinarum). This disease is very harmful because of its cause decrease in egg production and high morbidity. Snot incident in Indonesia still is reported. Vaccination is one of the best preventive measures, but reports about Av. paragallinarum serotype at the field so lack so that the correspondence between serotype Av. paragallinarum in the field to those used for vaccination is unknown. Av. paragallinarum has strains with different antigenicity and until now known three serotypes there are serotypes A, B and C. Serotypes A and C are pathogenic then serotypes B. The purpose of this study was to isolate, identify and to determine the serotype of Av. paragallinarum from the commercial layer that showing symptoms of snot. Samples were taken from layer which showed symptoms of snot (nasal foul smelling exudate, infra-orbital and wattle swelling, conjunctivitis, and snoring) from some layer farms. Samples were cultured on chocolate agar and then incubated in a candle jar at 37 ᴼC for 18-24 hours. Bacteria colony and cell morphology were observed and performed biochemical tests (catalase, oxidase, urease, indole, and fermentation of carbohydrates) in suspected colonies. Serotypes test was conducted using plate agglutination test (PAT). This study revealed 4 isolates Av. paragallinarum with 2 isolates are serotype B and 2 other are serotype C

Isolasi dan Identifiicasi Serologis Virus Avian Influenza Dari Sampel Unggas Yang Diperoleh di D.I. Yogyakarta dan Jawa Tengah = Isolation and Serological Identification of Avian Influenza Virus From Poultry Sample ...

Avian Influenza (AI) merupakan penyakit penting pada unggas, karena dapat menyebabkan kerugian ekonomi secara signifikan, dengan tingkat morbiditas dan mortalitas penyakit sangat tinggi. L,ebih dan itu potensi penularan penyakit AI dari hewan ke manusia, memberikan dampak ekonomi tersendiri. Beberapa kasus yang diduga sebagai AI banyak mewabah di beberapa daerah di Indonesia. Penyakit tersebut cukup membingungkan peternak dan sangat dikacaukan dengan penyakit Newcastle (ND) karena kedua penyakit mempunyai kemiripan karakter dan gejala klinis. Penelitian ini bertujuan untuk mengkonfirmasi apakah wabah penyakit tersebut disebabkan oleh virus AI atau virus ND. Sampel isolasi diambil dari paru atau trakhea, kemudian diproses lebih lanjut untuk diisolasi, dipropagasi secara in ovo menggunakan telur ayam berembrio umur 9 sampai 12 hari, spesific pathogen free atau telur yang setidaknya bebas antibodi terhadap virus AI. Teknik isolasi menurut standar prosedur Office International des Epizooties (01E) dan kemungkinan adanya pertumbuhan virus diuji terhadap kemampuan mengaglutinasi sel darah merah ayam atau hemaglutinasi (HA). Uji HA positif, mengindikasikan ada pertumbuhan virus ND atau virus AL Kedua jenis virus tersebut dapat dibedakan dengan uji hemaglutinasi inhibisi (HI) menggunakan serum anti dari masing-masing virus yang diuji. Berdasarkan hasil penelitian ini dapat diambil suatu kesimpulan bahwa beberapa sampel unggas, yaitu: ayam petelur, ayam broiler, ayam kampung, dan burung puyuh, yang di peroleh dari beberapa daerah di D.I. Yogyakarta dan Jawa Tengah dan secara klinis menunjukkan gejala tersifat maupun tidak tersifat AI, secara serologis dapat dikonfirmasi sebagai virus avian influenza sub-tipe 145Ni. Kata kunci : avian influenza, isolasi virus, hemaglutinasi, antibodi spesifik Avian influenza (Al) has been an important disease in poultry, and produces highly economic losses due to high mortality rate and zoonotic potential. Recently, there were some cases suspected as Al virus infection, which could be confused with Newcastle disease (ND), since both diseases have some similarity in symptoms and clinical signs. Based on the fascinating fact, the objective of this study was to confirm that the outbreak of some diseases in chicken, in some area were due to AI virus (AIV) or ND virus (NDV). Specimen taken from the lung or trachea was further processed. Suspected material were inoculated into allantoic sac of chicken embryo egg of 9-12 days old, which were specific pathogen free or at least specific antibody negative to AIV. The growth of the virus will be observed by the ability to agglutinate the chicken red blood cell or hemaglutination (HA) test. HA positive indicated the growth of both MV or NDV. The hemaglutination inhibition (HI) test using specific antibody was then applied to confirmed the presence of AIV. Method for isolation and identification were based on Office International des Epizooties procedures. Results indicated that AIV infection among poultry, included: layer, broiler, native chicken, and japanese quail, with specific lesion or unspecific lesion, were confirmed as avian influenza virus sub-type H5NI, based on virus isolation and serological identification. Key words: avian influenza, virus isolation, hemaglutination, specific antibody

MP-16 Characterization of Avibacterium paragallinarum Caused Infectious coryza/Snot: Satellite Colony Phenomenon

Infectious coryza (IC) is an acute upper respiratory disease of poultry that can appear in all ages. Some of clinical signs that are commonly seen in IC are rhinitis, facial swelling or edema, lacrimation, anorexia, and retarded growth in young poultry [1.2.3]. The disease can be found worldwide, especially in tropical countries [4]. Infectious coryza is very important in the chicken farm industry in developed and developing countries, including Indonesia [5]. The large economic losses due to IC such as increased number of culling, decreased egg production (10-40%), decreased body weight, stunting growth, and some mortality (2-10%) [4].Avibacterium paragallinarum which was previously classified as Haemophilus paragallinarum is a causative agent of infectious coryza in laying and broiler chickens, quail, pearl chicken, turkey, and peacocks [4,6,7,8]. The bacteria is commensal in the mucous membrane of the upper respiratory system, is sensitive to preservation and does not last long outside the host body [8]. Factors X and V are needed for the growth of several types of A. paragallinarum. According to in vitro growth requirements, A. paragallinarum can be either nicotinamide adenine dinucleotide (NAD) independent or NAD-dependent. The reduced form of NAD (NADH; 1.56-25 µg/ml) and the oxidized form (20-100 µg/ml) is required for in vitro growth in most isolates A. paragallinarum that show satellitic colony on a medium [9]. The description of the need for V factor of field isolates A. paragalinarum has been few reported. The aim of this research is to find out the phenomenon of satellite colonies from a variety of poultry isolates

Deteksi dan Identifikasi Cemaran Virus Avian Influenza pada Pasar Tradisional di Kabupaten Aceh Besar dan Kota Banda Aceh

Penelitian ini dirancang untuk mendeteksi keberadaan virus AI pada beberapa titik kritis, yaitu unggas, kandang penampungan sementara, tempat pemotongan dan penjualan karkas, dan mengidentifikasi subtipe virus AI pada beberapa pasar tradisional di Kabupaten Aceh Besar dan Kota Banda Aceh, Propinsi Aceh. Sampel swab diambil secara acak (random) dari empat pasar di Kabupaten Aceh Besar dan Kota Banda Aceh, Propinsi Aceh, yaitu pasar Lambaro, Ketapang, Ulekareng dan Peunayong, dan dipoolkan. Satu pool sampel berisi 1 sampai 5 swab yang dikelompokkan berdasarkan pedagang, jenis unggas, dan titik kritis cemaran AI. Jumlahtotal sampel yang diambil adalah 314 swab, yang terdiri dari swab trakea unggas hidup, kandang penampungan, meja tempat pemotongan, dan karkas, kemudian dikelompokkan dalam 121 pool. Isolasi virus AI kedalam telur ayam bertunas (TAB), pemeriksaan secara serologis (uji HA/HI), dan identifikasi molekuler (metode RT-PCR) di lakukan di bagian Virologi Laboratorium Veteriner, dinas Kesehatan Hewan dan Peternakan Provinsi Aceh, dan Laboratorium Riset Terpadu Fakultas Kedokteran Hewan Universitas Syiah Kuala Banda Aceh. Analisis hasil pemeriksaan serologis dan identifikasi molekuler virus AI dilakukan dengan metode deskriptif. Hasilisolasi virus pada TAB menunjukkan bahwa embrio mengalami kematian pada 1 hari setelah di infeksikan dengan material virus dari sampel swab yang berasal dari pasar Lambaro Kabupaten Aceh Besar, dan titer antibodi terhadap virus AI hanya terdeteksi pada itik dan ayam pedaging yang berkisar antara 24 sampai dengan 27. Dari hasil serologis tersebut dilanjutkan dengan pemeriksaan RT-PCR. Berdasarkan hasil uji RT-PCR menggunakan primer spesifik terhadap gen M, H5, dan N1 diperoleh virus AI yang bersirkulasi pada unggas di pasar Lambaro tergolong subtipe H5N1. Hasil penelitian ini membuktikan bahwa diantara beberapa titik kritiscemaran virus AI di pasar tradisional, unggas hidup (itik dan ayam pedaging) yang berada dalam kandang penampungan sementara merupakan potensial penyebaran virus AI ke lingkungannya

Kajian Kasus-kontrol Avian Influenza Pada Unggas di Jawa Timur, Jawa Tengah dan Daerah Istimewa Yogyakarta= A Case-control Study on Avian Influenza in Poultry in East Java, Central Java and Yogyakarta Special Province.

Kajian kasus-kontrol yang dirancang untuk menyidik kejadian avian influenza (Al) dan mencari hubungannya dengan faktor resiko penyakit, telah dilakukan terhadap 218 dusun di Jawa Timur, Jawa Tengah dan Daerah Istimewa Yogyakarta. Sebagai kasus (109 dusun) adalah dusun yang pernah dilaporkan atau sedang mengalami kasus AI, dan kontrol (109 dusun), adalah dusun yang dilaporkan belum pernah mengalami, tetapi dekat dengan dusun kasus. Kuesioner digunakan untuk menjaring variabel yang diperkirakan berasosiasi dengan kejadian AI. Data yang diperoleh dianalisis dengan Chi Square (x2) dan odds ratio (OR). Hasil kajian menunjukkan bahwa faktor adanya hewan pengerat (OR = 1,90), faktor adanya burung liar (OR = 24,00), faktor pekerja pulang sehabis kerja (OR = 2,65), dan faktor sektor III (OR = 1,79) mempunyai asosiasi karat dengan kejadian AI di suatu dusun, sedangkan beberapa faktor biosekuriti berasosiasi lemah (OR = 1,0 â 1,5) terhadap kejadian Al. Kata kunci: kasus-kontrol, avian influenza, odds ratio A subvillage based case-control study was conducted in the province of East Java, Central Java and Yogyakarta Special Province to investigate the association between the occurence of avian influenza (Al) in poultry and its possible risk factors. A total of 109 subvillage previously reported as having AI cases was chosen as cases and 109 AI free subvillages located next to each case subvillage were selected as controls. Possible associated factors were obtained by means of a questionnaire. The data were subsequently analized using x2 and odds ratio for possible association. The results showed strong association between AI cases and the existence of rodents (OR = 1,90), wild birds (OR = 24,00), and small commercial farms (OR = 1,79). Biosecurity factors gave weaks association (OR = 1,0 â 1,5) with AI cases. Key words: case-control, avian influenza, odds rati