1,114 research outputs found
Periods Of Weed Interference In Maize Crops Cultivated In The First And Second Cycles
The interference of weeds in maize production may be reflected in grain yield losses that vary as a function of the density, stage and degree of aggressiveness of the species present. In the agricultural ecosystem, crops and weeds demand light, water, nutrients and space, which are frequently not available in sufficient quantities, leading to competition. The aim of this work was to determine the period of interference of weed plants, in particular of naked crabgrass (Digitaria nuda) on maize crop in the first and second harvest. The treatments were defined as increasing periods of coexistence and increasing control of weed community (7, 14, 21, 28, 35, 42, 49, and 56 days), two more controls, a control including one with weed control until the end of the culture cycle and another with coexistence until the harvest. For each period, were evaluated the stand of maize plants, length of ear, number of grains per row, number of rows per ear, cob, 100-grain weight, and grain productivity. The data obtained were subjected to analysis of variance using the F test, with average treatments compared using Tukey's test at 5% probability. Crop productivity was evaluated by means of regressions, the critical periods of interference were estimated. The critical timing of weed removal was 25 days for both harvests. The critical weed free period was 54 and 27 days for the first and second harvest respectively. For the conditions of the first and second harvest, the critical period of weed control was of 29 and 2 days respectively.3752867287
Posicionamento do túnel femoral na reconstrução artroscópica do LCA: estudo comparativo de duas técnicas
OBJECTIVE: To compare the accuracy of positioning of the femoral tunnel in reconstructing the anterior cruciate ligament by means of 2 techniques: tibial tunnel and anteromedial portal. METHOD: Femoral tunnels were drilled in 20 knees from human cadavers by means of arthroscopy. Group I had the femoral tunnel drilled via a trans-tibial tunnel, and Group II via the anteromedial portal. Four variables were measured: A) posterior wall thickness; B) tunnel positioning at the notch; C) tunnel inclination in relation to the femoral axis; and D) distance between the wire guide exit and the lateral epicondyle. RESULTS: As above, respectively, A) 2.23 mm for group I and 2.36 mm for group II (P =.54); B) 25.5° for group I and 30.0° for group II (P =.23); C) 23.9° for group I and 32.0° for group II (P =.02); D) 7.8 cm for group I and 3.9 cm for group II (POBJETIVO: Comparar a acurácia do posicionamento do túnel femoral na reconstrução do ligamento cruzado anterior através de duas vias: túnel tibial e portal ântero - medial. MÉTODO: Foram perfurados túneis femorais em vinte joelhos de cadáveres humanos por via artroscópica. Grupo I: túnel femoral por acesso trans túnel tibial. Grupo II: via portal ântero-medial. Quatro variáveis foram estudadas: A) espessura da parede posterior; B) posicionamento do túnel no intercôndilo; C) angulação do túnel em relação ao eixo do fêmur; D) distância entre a saÃda do fio guia e o epicôndilo lateral. RESULTADO: A) grupo I: 2,23 mm, grupo II: 2,36 mm (p=0,543); B) grupo I: 25,5º, grupo II: 30º (p=0,226); C) grupo I: 23,9º, grupo II: 32º (p= 0,014); D) grupo I: 7,8 cm, grupo II 3,9 cm (
Controle social na prestação regionalizada no serviço de saneamento básico
[Purpose] Â This article addresses the configuration of social control as a constitutional principle and its importance within the scope of Law no. 11,445/2007.
[Methodology/approach/design] It analyzes the rules of social control in Law no. 11,445/2007 and the impact of changes promoted by Law no. 14,026/2020.
[Findings] It identifies the influence of social control on the regionalization of the basic sanitation service and the legality of the Paulista Law no. 17,231/2021, from the viewpoint of social control, which instituted regional units in the State of Sao Paulo.[Purpose] Â This article addresses the configuration of social control as a constitutional principle and its importance within the scope of Law no. 11,.445/2007.
[Methodology/approach/design] It analyzes the rules of social control in Law no. 11,445/2007 and the impact of changes promoted by Law no. 14,026/2020.
[Findings] It identifies the influence of social control on the regionalization of the basic sanitation service and the legality of the Paulista Law no. 17,231/2021, from the viewpoint of social control, which instituted regional units in the State of Sao Paulo.[Propósito] Este trabalho verifica a configuração do controle social como princÃpio constitucional e a sua importância no âmbito da Lei 11.445/2007.
[Metodologia/abordagem/design] São analisadas as regras do controle social na Lei 11.445/2007 e o impacto das alterações promovidas pela Lei 14.026/2020.
[Resultados] Ao final, este artigo identifica a influência do controle social na regionalização do serviço de saneamento básico e a legalidade da Lei Paulista 17.231/21 no aspecto do controle social, que instituiu unidades regionais no Estado de São Paulo.
Women and working in healthcare during the Covid-19 pandemic in Brazil: bullying of colleagues
Background: Based on a feminist approach, we analyzed the experiences of workplace bullying suffered by women front-line healthcare professionals dealing with the Covid-19 pandemic. We start from studies that show that women make up 70% of the global health workforce, 85% in the area of nursing, and 90% in the case of social care workers. An unequivocal need thus exists to address gender issues regarding the composition of the labor force in the health area. The pandemic has aggravated recurring problems involving healthcare professionals at the various caregiving levels, such as mental harassment (bullying) and its effects on mental health.
Methods: Data were gathered from an online survey of a convenience (non-probability) sample composed of 1,430 volunteer respondents, all women that work in the public health system in Brazil. The analyses and discussions involved the responses to a questionnaire containing 12 closed-ended questions and one open-ended question.
Results: The results revealed a context of workplace bullying aggravated by precarious material, institutional and organizational conditions in the area of health services against the backdrop of the Covid-19 pandemic in Brazil. This context has variously led to aggression, isolation, heavy workloads, and invasion of privacy, humiliation, persecution and fear as it was possible to see, mainly, in the answers to the study’s open-ended question. This situation degrades both work relations and the integrity of the healthcare professionals who work on the front line to treat Covid-19 cases.
Conclusion: We conclude that bullying is a psychosocial phenomenon that heightens the oppression and subordination still experienced by women in the contemporary context, but with new hues in a scenario of frontline response to Covid-19
Prevalência e fatores associados aos sintomas urinários na doença de Parkinson
The authors present a cross-sectional study involving 61 patients with idiopathic Parkinson's disease (PD) who were consecutively examined and compared to a control group with 74 subjects. Only patients who fulfilled the standard diagnostic criteria for PD and whose brain magnetic resonance imaging was normal were included. The objective of the study was to evaluate the prevalence of inferior urinary tract symptoms in PD and to study the possible association between clinical factors to urinary dysfunction. ln the patient group, 39.3% presented urinary symptoms when compared to 10.8% in the control group. All symptomatic patients presented irritative symptoms. The most common irritative symptom PD was nocturia, followed by frequency and urinary incontinence. Around 25% of the patients presented functional obstructive symptoms determined by the disease. The most frequent obstructive symptom was incomplete emptying of the bladder. Only the age of the patients and control group were correlated with urinary dysfunction.Trata-se de estudo clÃnico transversal, envolvendo 61 pacientes com doença de Parkinson idiopática (DP) examinados consecutivamente e comparados a 74 indivÃduos do grupo controle. Foram incluÃdos apenas pacientes com DP que preencheram os critérios de diagnóstico estabelecidos. A ressonância magnética do encéfalo e a ultra-sonografia da próstata foram utilizadas como critérios de exclusão. O objetivo do estudo foi avaliar a prevalência de sintomas do trato urinário inferior na DP e verificar associações entre sexo, idade e fatores clÃnicos à s disfunções urinárias. Sintomatologia urinária foi encontrada em 39,3% dos parkinsonianos e 10,8% do grupo controle. Todos os pacientes sintomáticos apresentavam sintomas irritativos e 25% destes tinham sintomas obstrutivos. A sintomatologia urinária não estava associada ao sexo, duração e gravidade da doença, hipotensão postural e sintomas ortostáticos, assim como com os sinais cardeais e tratamento com a levodopa.35936
Prevalence of Campylobacter fetus subsp. venerealis in Dairy Cows from Brejo Paraibano, Brazil
Background: Bovine genital campylobacteriosis (BGC) results in an increase in the interval between calving, increase in age at first calving, increase in the number of doses of semen or services by conception, and reduction in the number of animals born and weaned. Due to the importance of cattle breeding in Brazil, to the impact of BGC on bovine reproductive health, and since campylobacteriosis has never been studied in this region of Brazil, epidemiological studies on C. fetus infection in bovine herds are essential. The objective of this study was to determine prevalence of Campylobacter fetus subsp. venerealis infection in dairy cows from the Brejo Paraibano region, northeastern Brazil.Materials, Methods & Results: A cross-sectional study was conducted to determine prevalence of animals infected by C. fetus subsp. venerealis. In order to compose the sample of the number of farms, a total of 30 farming establishments with milk cattle and expected prevalence of 1.8%, 95% confidence interval (CI) and statistical error of 5% were considered, which provided a minimum of 15 farms. Samples of cervico-vaginal mucus were collected from 273 dairy cows from 19 farms. Polymerase chain reaction was used for laboratory diagnosis using the oligonucleotides VENSF1 (5’CTTAGCAGTTTGCGATATTGCCATT3’) and VENS2 (5’GCTTTTGAGATAACAATAAGAGCTT3’) for detection of a 142 base-pairs product. In order to confirm the results, positive samples were purified after amplification and bidirectional sequenced. A thematic map was prepared with prevalence distributions in the studied area. The prevalence of C. fetus subsp. venerealis infection in cows was 7.7% (confidence interval [CI] 95%, 4.8%-11.5%), and 31.6% (6/19) of the farms showed at least one positive animal. Of the six counties surveyed, all (100.0%) had positive animals, with a positive farm per county. Regarding age, it was observed that all positive animals were between two and 15 years old, with a mean age of 6.2 years.Discussion: This is the first report of C. fetus subsp. venerealis infection in dairy cows in this region of Brazil. In this microregion, 7.7% (21) were positive in the PCR. Considering only the samples of females, in Brazil a result close to that of the present study was obtained in the Federal District and Goiás, where a prevalence of 10.5% (27/258) was determined using direct immunofluorescence (DIF) in samples of uterine and vaginal swabs from animals slaughtered in slaughter houses. However, the prevalence observed in the present study was lower than that generally reported, including in other regions of the country. In Minas Gerais, a prevalence of 25.5% (40/157) was found using DIF in samples of cervical-vaginal mucus from cows from herds with reproductive problems. In the state of Rio Grande do Sul, 13.6% of samples from cows were PCR positive. The use of high sensitivity tests, such as PCR, which can detect a small number of microorganisms, is important in studies of this nature. The prevalence of farms with positive animals, associated with the detection of infection in cattle of all the counties surveyed, makes it possible to affirm that C. fetus subsp. venerealis infection is present in cattle in the Brejo Paraibano microregion. This study demonstrates the presence of C. fetus subsp. venerealis DNA in dairy cows in the surveyed region. It is recommended to adopt an artificial insemination program on the farms, as well as a vaccination program to stimulate immunity in order to reduce the occurrence of infection and possible reproductive problems
Clinical Treatment Of Resistant Epilepsy
[No abstract available]46435135
Clinical treatment of resistant epilepsy
The authors analysed 34 cases of resistant epilepsy (20 males and 14 females, mean age 23 years), treated clinically between February/1984 and May/1986. The patients underwent neurological, neuropsychological, psychological, psychiatric, cerebrospinal fluid, electroencephalographic, tomographic and/or angiographic examination. Most of the patients had complex partial seizures. The etiology was unknown in 19 patients (55.8%), probable neurocysticercosis in 6, perinatal hypoxia in 5, delivery trauma in 3 and probable sequelae of encephalitis in 2 patients. There was a clear past history of infantile febrile convulsion in 2 patients. Most patients received carbamazepine (mean dose 24.5 mg/kg/day), phenytoin (5 mg/kg and valproic acid (28 mg/kg) as monotherapy or in association. Twenty-two patients (64.7%) had more than 80% decrease of the seizure frequency. Nine resistant epilepsy-cases (24.5%) were evaluated as candidates for surgical therapy. The authors concluded that the resistant epilepsy is best managed by a specialised, multidisciplinary team, and pointed out the need of a correct diagnosis of the seizure type, an adequate drug therapy and a good engagement of the patient and his family in the treatment.Foram estudados 34 casos de epilepsia de difÃcil controle, encaminhados ao Grupo de Trabalho de Epilepsia (GTE) do Instituto de Neurologia de Goiânia de 1984 a 1986. Todos eram submetidos a reavaliação neurológica. Vinte e três dos 34 pacientes tinham crises parciais complexas. A maioria foi tratada com carbamazepina, difenil-hidantoÃna e ácido valpróico, em forma monoterápica ou associada entre si. Obteve-se redução de mais de 80% da freqüência das crises em 22 pacientes (64,7%), além de leve melhora da qualidade de vida. Os autores concluem sobre as vantagens de uma equipe especializada, multidisciplinar, na abordagem da epilepsia rebelde e ressaltam a necessidade de: a. um correto diagnóstico das crises, seguido do uso da medicação apropriada, por tempo suficiente (mÃnimo de 0 meses) e em dose adequada (até a dose máxima tolerável), abandonando-a só depois do controle de sua concentração sérica; b. um bom engajamento do paciente e de sua famÃlia no tratamento.35135
Uncomplicated acute cholecystitis: early or delayed laparoscopic cholecystectomy?
Recent meta-analyses suggested that early laparoscopic cholecystectomy (within 1 week of symptom onset) for uncomplicated acute gallbladder disease is safe and feasible. However, surveys on surgical practices indicated that early laparoscopic cholecystectomy is performed by only a minority of surgeons. Furthermore, the exact time-point for performing this procedure as well as its cost-effectiveness remain a matter of debate. The TBE - CiTE Journal Club performed a critical appraisal of the most relevant evidence recently published on timing of laparoscopic cholecystectomy and its cost-effectiveness for the management of uncomplicated acute cholecystitis and provides evidence-based recommendations on the topic. The literature encompasses small trials with high risk of biases. It suggests that early laparoscopic cholecystectomy is safe and shortens hospital stay. There is scarcity of well-designed and large cost-utility analyses. The following main recommendations were generated: (1) Early laparoscopic cholecystectomy should be attempted as the first-line treatment within one week of symptoms onset; and (2) The cost-effectiveness of early laparoscopic cholecystectomy should be evaluated at the individual hospital level, taking into consideration local resources such as the availability of trained personal, operating room and laparoscopic equipment.Metanálises recentes sugerem que a colecistectomia laparoscópica precoce (dentro de uma semana do inÃcio dos sintomas) para a doença aguda, não complicada, da vesÃcula biliar é segura e viável. No entanto, enquetes sobre as práticas cirúrgicas indicam que a colecistectomia laparoscópica precoce é realizada por apenas uma minoria dos cirurgiões. Além disso, o melhor momento para realização deste procedimento, bem como sua relação custo-eficácia continuam sendo uma questão de debate. A reunião de revista TBE - CiTE realizou uma avaliação crÃtica dos artigos mais relevantes, publicados recentemente, sobre o momento da colecistectomia laparoscópica e sua relação custo-eficácia para o tratamento da colecistite aguda não complicada e fornece recomendações baseadas em evidências sobre o tema. A literatura engloba pequenos ensaios com alto risco para vieses. Ela sugere que colecistectomia laparoscópica precoce é segura e encurta o perÃodo de internação. Há uma escassez de estudos bem desenhados e de grandes séries analisando custo-utilidade. As seguintes recomendações foram geradas: (1) a colecistectomia laparoscópica precoce deve ser tentada como o tratamento de primeira linha dentro de uma semana do inÃcio dos sintomas, e (2) O custo-efetividade da colecistectomia laparoscópica precoce deve ser avaliada em cada local, levando-se em consideração os recursos, tais como a disponibilidade de pessoal treinado e de equipamentos laparoscópicos.43644
- …