A multilocus sequence analysis of Xanthomonas campestris reveals a complex structure within crucifer-attacking pathovars of this species

Previous classification of Xanthomonas campestris has defined six pathovars (aberrans, armoraciae, barbareae, campestris, incanae, and raphani) that cause diseases on cruciferous plants. However, pathogenicity assays with a range of strains and different hosts identifies only three types of symptom: black rot, leaf spot and bacterial blight. These findings raise the question of the genetic relatedness between strains assigned to different pathovars or symptom phenotypes. Here we have addressed this issue by multilocus sequence analysis of 42 strains. The X. campestris species was polymorphic at the 8 loci analysed and had a high genetic diversity; 23 sequence types were identified of which 16 were unique. All strains that induce black rot (pathovars aberrans and campestris) were genetically close but split in two groups. Only three clonal complexes were found, all within pathovar campestris. The assignment of the genome-sequenced strain 756C to pathovar raphani suggested from disease symptoms was confirmed, although this group of strains was particularly polymorphic. Strains belonging to pathovars barbareae and incanae were closely related, but distinct from pathovar campestris. There is evidence of genetic exchanges of housekeeping genes within this species as deduced from a clear incongruence between individual gene phylogenies and from network structures from SplitsTree analysis. Overall this study showed that the high genetic diversity derived equally from recombination and point mutation accumulation. However, X. campestris remains a species with a clonal evolution driven by a differential adaptation to cruciferous hosts

Aggressive Emerging Pathovars of Xanthomonas arboricola Represent Widespread Epidemic Clones Distinct from Poorly Pathogenic Strains, as Revealed by Multilocus Sequence Typing

Deep and comprehensive knowledge of the genetic structure of pathogenic species is the cornerstone on which the design of precise molecular diagnostic tools is built. Xanthomonas arboricola is divided into pathovars, some of which are classified as quarantine organisms in many countries and are responsible for diseases on nut and stone fruit trees that have emerged worldwide. Recent taxonomic studies of the genus Xanthomonas showed that strains isolated from other hosts should be classified in X. arboricola, extending the host range of the species. To investigate the genetic structure of X. arboricola and the genetic relationships between highly pathogenic strains and strains apparently not relevant to plant health, we conducted multilocus sequence analyses on a collection of strains representative of the known diversity of the species. Most of the pathovars were clustered in separate monophyletic groups. The pathovars pruni, corylina, and juglandis, responsible for pandemics in specific hosts, were highly phylogenetically related and clustered in three distinct clonal complexes. In contrast, strains with no or uncertain pathogenicity were represented by numerous unrelated singletons scattered in the phylogenic tree. Depending on the pathovar, intra- and interspecies recombination played contrasting roles in generating nucleotide polymorphism. This work provides a population genetics framework for molecular epidemiological surveys of emerging plant pathogens within X. arboricola. Based on our results, we propose to reclassify three former pathovars of Xanthomonas campestris as X. arboricola pv. arracaciae comb. nov., X. arboricola pv. guizotiae comb. nov., and X. arboricola pv. zantedeschiae comb. nov. An emended description of X. arboricola Vauterin et al. 1995 is provided

Pseudomonas cannabina pv. cannabina pv. nov., and Pseudomonas cannabina pv. alisalensis (Cintas Koike and Bull, 2000) comb. nov., are members of the emended species Pseudomonas cannabina (ex Šutič & Dowson 1959) Gardan, Shafik, Belouin, Brosch, Grimont

Sequence similarity in the 16S rDNA gene confirmed that crucifer pathogen Pseudomonas syringae pv. alisalensis belongs to P. syringae sensu lato. In reciprocal DNA/DNA hybridization experiments, DNA relatedness was high (69–100%) between P. syringae pv. alisalensis strains and the type strain of P. cannabina (genomospecies 9). In contrast, DNA relatedness was low (below 48%) between P. syringae pv. alisalensis and reference strains from the remaining genomospecies of P. syringae including the type strain of P. syringae and reference strain of genomospecies 3 (P. syringae pv. tomato) although the well-known crucifer pathogen, P. syringae pv. maculicola, also belongs to genomospecies 3. Additional evidence that P. syringae pv. alisalensis belongs to P. cannabina was sequence similarity in five gene fragments used in multilocus sequence typing, as well as similar rep-PCR patterns when using the BOX-A1R primers. The description of P. cannabina has been emended to include P. syringae pv. alisalensis. Host range testing demonstrated that P. syringae pv. alisalensis strains, originally isolated from broccoli, broccoli raab or arugula, were not pathogenic on Cannabis sativa (family Cannabinaceae). Additionally, P. cannabina strains, originally isolated from the C. sativa were not pathogenic on broccoli raab or oat while P. syringae pv. alisalensis strains were pathogenic on these hosts. Distinct host ranges for these two groups indicate that P. cannabina emend. consists of at least two distinct pathovars, P. cannabina pv. cannabina pv. nov., and P. cannabina pv. alisalensis comb. nov. Pseudomonas syringae pv. maculicola strain CFBP 1637 is a member of P. cannabina

Electrical valley filtering in transition metal dichalcogenides

This work investigates the feasibility of electrical valley filtering for holes in transition metal dichalcogenides. We look specifically into the scheme that utilizes a potential barrier to produce valley-dependent tunneling rates, and perform the study with both a k.p based analytic method and a recursive Green's function based numerical method. The study yields the transmission coefficient as a function of incident energy and transverse wave vector, for holes going through lateral quantum barriers oriented in either armchair or zigzag directions, in both homogeneous and heterogeneous systems. The main findings are the following: 1) the tunneling current valley polarization increases with increasing barrier width or height, 2) both the valley-orbit interaction and band structure warping contribute to valley-dependent tunneling, with the former contribution being manifest in structures with asymmetric potential barriers, and the latter being orientation-dependent and reaching maximum for transmission in the armchair direction, and 3) for transmission ~ 0.1, a tunneling current valley polarization of the order of 10% can be achieved.Comment: 12 pages, 8 figure

Procédé de dépistage de Xanthomonas axonopodis pv. phaseoli

Screening Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprises detecting a combination (C1) of two genes of the combination AvrBsT/Xac3090, the combination AvrBsT/XopP, and the combination AvrBsT/AvrXccB, where the result of the screening process is positive if the presence of two genes of the combination (C1) is detected in the biological sample. Independent claims are included for: (1) a nucleotide probe or primer used in a method of screening Xanthomonas axonopodis pathovar phaseoli, where the primer or the probe has a length of 12-30 nucleotides and comprising at least 12 consecutive nucleotides from a nucleic acid of the nucleic acid sequence of SEQ ID NOs: 5-12 (e.g. ccatgctgagcacggtcatt (SEQ ID NO: 5), cgccttccagttgctgacat (SEQ ID NO: 6), acgagcccttcccaaactagc (SEQ ID NO: 7), taccaacatcgtacgcttccc (SEQ ID NO: 8), cgtcagtgagtgctcggttg (SEQ ID NO: 9) and tcagagccctggaagcaaga (SEQ ID NO: 10)), and the nucleic acids of complementary sequence; and (2) a kit for detection of Xanthomonas axonopodis pathovar phaseoliin a biological sample, comprising two pairs of primers for amplifying the combination of the two genes (C1) and the nucleotide probe or primer

Comparative Genomics of Pathogenic and Nonpathogenic Strains of Xanthomonas arboricola Unveil Molecular and Evolutionary Events Linked to Pathoadaptation

The bacterial species Xanthomonas arboricola contains plant pathogenic and nonpathogenic strains. It includes the pathogen X. arboricola pv. juglandis, causing the bacterial blight of Juglans regia. The emergence of a new bacterial disease of J, regia in France called vertical oozing canker (VOC) was previously described and the causal agent was identified as a distinct genetic lineage within the pathovar Symptoms on walnut leaves and fruits are similar to those of a bacterial blight but VOC includes also cankers on trunk and branches. In this work, we used comparative genomics and physiological tests to detect differences between four X. arboricola strains isolated from walnut tree: strain CFBP 2528 causing walnut blight (WB), strain CFBP 7179 causing VOC and two nonpathogenic strains, CFBP 7634 and CFBP 7651, isolated from healthy walnut buds. Whole genome sequence comparisons revealed that pathogenic strains possess a larger and wider range of mobile genetic elements than nonpathogenic strains. One pathogenic strain, CFBP 7179, possessed a specific integrative and conjugative element (ICE) of 95 kb encoding genes involved in copper resistance, transport and regulation. The type three effector repertoire was larger in pathogenic strains than in nonpathogenic strains. Moreover, CFBP 7634 strain lacked the type three secretion system encoding genes. The flagellar system appeared incomplete and nonfunctional in the pathogenic strain CFBP 2528. Differential sets of chemoreceptor and different repertoires of genes coding adhesins were identified between pathogenic and nonpathogenic strains. Besides these differences, some strain-specific differences were also observed. Altogether, this study provides valuable insights to highlight the mechanisms involved in ecology, environment perception, plant adhesion and interaction, leading to the emergence of new strains in a dynamic environment

Optically Implemented Broadband Blueshift Switch in the Terahertz Regime

Cataloged from PDF version of article.We experimentally demonstrate, for the first time, an optically implemented blueshift tunable metamaterial in the terahertz (THz) regime. The design implies two potential resonance states, and the photoconductive semiconductor (silicon) settled in the critical region plays the role of intermediary for switching the resonator from mode 1 to mode 2. The observed tuning range of the fabricated device is as high as 26% (from 0.76 THz to 0.96 THz) through optical control to silicon. The realization of broadband blueshift tunable metamaterial offers opportunities for achieving switchable metamaterials with simultaneous redshift and blueshift tunability and cascade tunable devices. Our experimental approach is compatible with semiconductor technologies and can be used for other applications in the THz regime

Development of multilocus variable-number tandem repeat analysis (MLVA) for Xanthomonas arboricola pathovars

Xanthomonas arboricola is an important bacterial species, the pathovars of which are responsible for bacterial blight diseases on stone fruit, hazelnut, Persian walnut, poplar, strawberry, poinsettia and banana. In this study, we evaluated variable number tandem repeats (VNTR) as a molecular typing tool for assessing the genetic diversity within pathovars of X. arboricola. Screening of the X. arboricola pv. pruni genome sequence (CFBP5530 strain) predicted 51 candidate VNTR loci. Primer pairs for polymerase chain reaction (PCR) amplification of all 51 loci were designed, and their discriminatory power was initially evaluated with a core collection of 8 X. arboricola strains representative of the different pathovars. Next, the 26 polymorphic VNTR loci present in all strains were used for genotyping a collection of 61 strains. MLVA is a typing method that clearly differentiates X. arboricola strains. The MLVA scheme described in this study is a rapid and reliable molecular typing tool that can be used for further epidemiological studies of bacterial diseases caused by X. arboricola pathovars

Room temperature strong light-matter coupling in three dimensional terahertz meta-atoms

We demonstrate strong light-matter coupling in three dimensional terahertz meta-atoms at room temperature. The intersubband transition of semiconductor quantum wells with a parabolic energy potential is strongly coupled to the confined circuital mode of three-dimensional split-ring metal-semiconductor-metal resonators that have an extreme sub-wavelength volume (λ/10). The frequency of these lumped-element resonators is controlled by the size and shape of the external antenna, while the interaction volume remains constant. This allows the resonance frequency to be swept across the intersubband transition and the anti-crossing characteristic of the strong light-matter coupling regime to be observed. The Rabi splitting, which is twice the Rabi frequency (2ΩRabi), amounts to 20% of the bare transition at room temperature, and it increases to 28% at low-temperatur