124 research outputs found
Recommended from our members
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed
The Effect of Antiretroviral Combination Treatment on Epstein-Barr Virus (EBV) Genome Load in HIV-Infected Patients
We evaluated the effect of combination anti-retroviral treatment (cART) on the host control of EBV infection in moderately immunosuppressed HIV-1 patients. Twenty HIV-1 infected individuals were followed for five years with repeated measurements of EBV DNA load in peripheral blood lymphocytes in relation to HIV-RNA titers and CD4+ cell counts. Individuals with optimal response, i.e. durable non-detectable HIV-RNA, showed a decline of EBV load to the level of healthy controls. Individuals with non-optimal HIV-1 control did not restore their EBV control. Long-lasting suppression of HIV-replication after early initiation of cART is a prerequisite for re-establishing the immune control of EBV
Possible Implication of Red Blood Cells in the Prothrombotic Risk in Early Rheumatoid Arthritis
Novel Schizophrenia Risk Gene TCF4 Influences Verbal Learning and Memory Functioning in Schizophrenia Patients
Background: Recently, a role of the transcription factor 4 (TCF4) gene in schizophrenia has been reported in a large genome-wide association study. It has been hypothesized that TCF4 affects normal brain development and TCF4 has been related to different forms of neurodevelopmental disorders. Schizophrenia patients exhibit strong impairments of verbal declarative memory (VDM) functions. Thus, we hypothesized that the disease-associated C allele of the rs9960767 polymorphism of the TCF4 gene led to impaired VDM functioning in schizophrenia patients. Method: The TCF4 variant was genotyped in 401 schizophrenia patients. VDM functioning was measured using the Rey Auditory Verbal Learning Test (RAVLT). Results: Carriers of the C allele were less impaired in recognition compared to those carrying the AA genotype (13.76 vs. 13.06; p = 0.049). Moreover, a trend toward higher scores in patients with the risk allele was found for delayed recall (10.24 vs. 9.41; p = 0.088). The TCF4 genotype did not influence intelligence or RAVLT immediate recall or total verbal learning. Conclusion: VDM function is influenced by the TCF4 gene in schizophrenia patients. However, the elevated risk for schizophrenia is not conferred by TCF4-mediated VDM impairment. Copyright (C) 2011 S. Karger AG, Base
Retrospective methods to estimate radiation dose at the site of breast cancer development after Hodgkin lymphoma radiotherapy.
BACKGROUND: An increased risk of breast cancer following radiotherapy for Hodgkin lymphoma (HL) has now been robustly established. In order to estimate the dose-response relationship more accurately, and to aid clinical decision making, a retrospective estimation of the radiation dose delivered to the site of the subsequent breast cancer is required. METHODS: For 174 Dutch and 170 UK female patients with breast cancer following HL treatment, the 3-dimensional position of the breast cancer in the affected breast was determined and transferred onto a CT-based anthropomorphic phantom. Using a radiotherapy treatment planning system the dose distribution on the CT-based phantom was calculated for the 46 different radiation treatment field set-ups used in the study population. The estimated dose at the centre of the breast cancer, and a margin to reflect dose uncertainty were determined on the basis of the location of the tumour and the isodose lines from the treatment planning. We assessed inter-observer variation and for 47 patients we compared the results with a previously applied dosimetry method. RESULTS: The estimated median point dose at the centre of the breast cancer location was 29.75Â Gy (IQR 5.8-37.2), or about 75% of the prescribed radiotherapy dose. The median dose uncertainty range was 5.97Â Gy. We observed an excellent inter-observer variation (ICC 0.89 (95% CI: 0.74-0.95)). The absolute agreement intra-class correlation coefficient (ICC) for inter-method variation was 0.59 (95% CI: 0.37-0.75), indicating (nearly) good agreement. There were no systematic differences in the dose estimates between observers or methods. CONCLUSION: Estimates of the dose at the point of a subsequent breast cancer show good correlation between methods, but the retrospective nature of the estimates means that there is always some uncertainty to be accounted for
Functional SARS-CoV-2 cross-reactive CD4+ T cells established in early childhood decline with age.
Pre-existing SARS-CoV-2-reactive T cells have been identified in SARS-CoV-2-unexposed individuals, potentially modulating COVID-19 and vaccination outcomes. Here, we provide evidence that functional cross-reactive memory CD4+ T cell immunity against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is established in early childhood, mirroring early seroconversion with seasonal human coronavirus OC43. Humoral and cellular immune responses against OC43 and SARS-CoV-2 were assessed in SARS-CoV-2-unexposed children (paired samples at age two and six) and adults (age 26 to 83). Pre-existing SARS-CoV-2-reactive CD4+ T cell responses targeting spike, nucleocapsid, and membrane were closely linked to the frequency of OC43-specific memory CD4+ T cells in childhood. The functional quality of the cross-reactive memory CD4+ T cell responses targeting SARS-CoV-2 spike, but not nucleocapsid, paralleled OC43-specific T cell responses. OC43-specific antibodies were prevalent already at age two. However, they did not increase further with age, contrasting with the antibody magnitudes against HKU1 (β-coronavirus), 229E and NL63 (α-coronaviruses), rhinovirus, Epstein-Barr virus (EBV), and influenza virus, which increased after age two. The quality of the memory CD4+ T cell responses peaked at age six and subsequently declined with age, with diminished expression of interferon (IFN)-γ, interleukin (IL)-2, tumor necrosis factor (TNF), and CD38 in late adulthood. Age-dependent qualitative differences in the pre-existing SARS-CoV-2-reactive T cell responses may reflect the ability of the host to control coronavirus infections and respond to vaccination
Long-Term Cause-Specific Mortality in Hodgkin Lymphoma Patients
BACKGROUND: Few studies have examined the impact of treatment-related morbidity on long-term, cause-specific mortality in Hodgkin lymphoma (HL) patients. METHODS: This multicenter cohort included 4919 HL patients, treated before age 51 years between 1965 and 2000, with a median follow-up of 20.2 years. Standardized mortality ratios, absolute excess mortality (AEM) per 10 000 person-years, and cause-specific cumulative mortality by stage and primary treatment, accounting for competing risks, were calculated. RESULTS: HL patients experienced a 5.1-fold (AEM = 123 excess deaths per 10 000 person-years) higher risk of death due to causes other than HL. This risk remained increased in 40-year survivors (standardized mortality ratio = 5.2, 95% confidence interval [CI] = 4.2 to 6.5, AEM = 619). At age 54 years, HL survivors experienced similar cumulative mortality (20.0%) from causes other than HL to 71-year-old individuals from the general population. Whereas HL mortality statistically significantly decreased over the calendar period (P < .001), solid tumor mortality did not change in the most recent treatment era. Patients treated in 1989-2000 had lower 25-year cardiovascular disease mortality than patients treated in 1965-1976 (4.3% vs 5.7%; subdistribution hazard ratio = 0.65, 95% CI = 0.46 to 0.93). Infectious disease mortality was not only increased after splenectomy but also after spleen irradiation (hazard ratio = 2.81, 95% CI = 1.55 to 5.07). For stage I-II, primary treatment with chemotherapy (CT) alone was associated with statistically significantly higher HL mortality (P < .001 for CT vs radiotherapy [RT]; P = .04 for CT vs RT+CT) but lower 30-year mortality from causes other than HL (15.8%, 95% CI = 9.7% to 23.3%) compared with RT alone (36.9%, 95% CI = 34.0% to 39.8%, P = .001) and RT and CT combined (29.8%, 95% CI = 26.8% to 32.9%, P = .02). CONCLUSIONS: Compared with the general population, HL survivors have a substantially reduced life expectancy. Optimal selection of patients for primary CT is crucial, weighing risks of HL relapse and long-term toxicity
multicenter cohort study
Publisher Copyright: © 2023 The Authors. Ultrasound in Obstetrics & Gynecology published by John Wiley & Sons Ltd on behalf of International Society of Ultrasound in Obstetrics and Gynecology.Objective: Monochorionic (MC) triplet pregnancies are extremely rare and information on these pregnancies and their complications is limited. We aimed to investigate the risk of early and late pregnancy complications, perinatal outcome and the timing and methods of fetal intervention in these pregnancies. Methods: This was a multicenter retrospective cohort study of MC triamniotic (TA) triplet pregnancies managed in 21 participating centers around the world from 2007 onwards. Data on maternal age, mode of conception, diagnosis of major fetal structural anomalies or aneuploidy, gestational age (GA) at diagnosis of anomalies, twin-to-twin transfusion syndrome (TTTS), twin anemia–polycythemia sequence (TAPS), twin reversed arterial perfusion (TRAP) sequence and or selective fetal growth restriction (sFGR) were retrieved from patient records. Data on antenatal interventions were collected, including data on selective fetal reduction (three to two or three to one), laser surgery and any other active fetal intervention (including amniodrainage). Data on perinatal outcome were collected, including numbers of live birth, intrauterine demise, neonatal death, perinatal death and termination of fetus or pregnancy (TOP). Neonatal data such as GA at birth, birth weight, admission to neonatal intensive care unit and neonatal morbidity were also collected. Perinatal outcomes were assessed according to whether the pregnancy was managed expectantly or underwent fetal intervention. Results: Of an initial cohort of 174 MCTA triplet pregnancies, 11 underwent early TOP, three had an early miscarriage, six were lost to follow-up and one was ongoing at the time of writing. Thus, the study cohort included 153 pregnancies, of which the majority (92.8%) were managed expectantly. The incidence of pregnancy affected by one or more fetal structural abnormality was 13.7% (21/153) and that of TRAP sequence was 5.2% (8/153). The most common antenatal complication related to chorionicity was TTTS, which affected just over one quarter (27.6%; 42/152, after removing a pregnancy with TOP < 24 weeks for fetal anomalies) of the pregnancies, followed by sFGR (16.4%; 25/152), while TAPS (spontaneous or post TTTS with or without laser treatment) occurred in only 4.6% (7/152) of pregnancies. No monochorionicity-related antenatal complication was recorded in 49.3% (75/152) of pregnancies. Survival was apparently associated largely with the development of these complications: there was at least one survivor beyond the neonatal period in 85.1% (57/67) of pregnancies without antenatal complications, in 100% (25/25) of those complicated by sFGR and in 47.6% (20/42) of those complicated by TTTS. The overall rate of preterm birth prior to 28 weeks was 14.5% (18/124) and that prior to 32 weeks' gestation was 49.2% (61/124). Conclusion: Monochorionicity-related complications, which can impact adversely perinatal outcome, occur in almost half of MCTA triplet pregnancies, creating a challenge with regard to counseling, surveillance and management.publishersversionpublishe
Identification of Methylated Genes Associated with Aggressive Clinicopathological Features in Mantle Cell Lymphoma
Background: Mantle cell lymphoma (MCL) is genetically characterized by the t(11;14)(q13;q32) translocation and a high number of secondary chromosomal alterations. The contribution of DNA methylation to MCL lymphomagenesis is not well known. We sought to identify epigenetically silenced genes in these tumours that might have clinical relevance. Methodology/Principal Findings: To identify potential methylated genes in MCL we initially investigated seven MCL cell lines treated with epigenetic drugs and gene expression microarray profiling. The methylation status of selected candidate genes was validated by a quantitative assay and subsequently analyzed in a series of primary MCL (n=38). After pharmacological reversion we identified 252 potentially methylated genes. The methylation analysis of a subset of these genes (n=25) in the MCL cell lines and normal B lymphocytes confirmed that 80% of them were methylated in the cell lines but not in normal lymphocytes. The subsequent analysis in primary MCL identified five genes (SOX9,HOXA9,AHR,NR2F2 ,and ROBO1) frequently methylated in these tumours. The gene methylation events tended to occur in the same primary neoplasms and correlated with higher proliferation, increased number of chromosomal abnormalities, and shorter survival of the patients. Conclusions: We have identified a set of genes whose methylation degree and gene expression levels correlate with aggressive clinicopathological features of MCL. Our findings also suggest that a subset of MCL might show a CpG island methylator phenotype (CIMP) that may influence the behaviour of the tumours
Ancestral SARS-CoV-2-specific T cells cross-recognize the Omicron variant
The emergence of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) Omicron (B.1.1.529) variant of concern (VOC) has destabilized global efforts to control the impact of coronavirus disease 2019 (COVID-19). Recent data have suggested that B.1.1.529 can readily infect people with naturally acquired or vaccine-induced immunity, facilitated in some cases by viral escape from antibodies that neutralize ancestral SARS-CoV-2. However, severe disease appears to be relatively uncommon in such individuals, highlighting a potential role for other components of the adaptive immune system. We report here that SARS-CoV-2 spike-specific CD4+ and CD8+ T cells induced by prior infection or BNT162b2 vaccination provide extensive immune coverage against B.1.1.529. The median relative frequencies of SARS-CoV-2 spike-specific CD4+ T cells that cross-recognized B.1.1.529 in previously infected or BNT162b2-vaccinated individuals were 84% and 91%, respectively, and the corresponding median relative frequencies for SARS-CoV-2 spike-specific CD8+ T cells were 70% and 92%, respectively. Pairwise comparisons across groups further revealed that SARS-CoV-2 spike-reactive CD4+ and CD8+ T cells were functionally and phenotypically similar in response to the ancestral strain or B.1.1.529. Collectively, our data indicate that established SARS-CoV-2 spike-specific CD4+ and CD8+ T cell responses, especially after BNT162b2 vaccination, remain largely intact against B.1.1.529
- …