Diversity of the Triticeae genetic resources in the Karabakh region of Azerbaijan

This paper gives an overview of the collection history for the species from the Triticeae Dum. tribe in the Karabakh region of Azerbaijan up to date of its occupation. By covering most of the Lesser Cau-casus with the semi-desert and dry steppe climate, the Karabakh region of Azerbaijan has favorable conditions for grass diversity. There are 14 genera from the tribe Triticeae in Azerbaijan, of which historically the 10 genera also were found in the Karabakh region. The data in this article have been presented as a summary of information recorded in different literature sources, that would be useful for the planned monitoring of status, distribution, and preserving issues for the Triticeae species in the liberated areas

Characterization and evaluation data of some leguminous plants stored in National Genebank

Characterization of plant genetic resources is the major description of germplazm for breeding. Their morpho-agronomic, biochemistry and molecular evoluation also plays an important role for creation new valuable varieties. With the support of information technologies it can be more effective collection, conservation and use of characterization and evluation data as a database format. So, for this purpose there were created characterization databases on leguminous plants within the structure of Central Databases System. As we mentioned above characterizing of each sample with more traits is very important for the breeding issues. We have tried to achieve it in our research also. For characterization and evaluation data we used international plant descriptors prepared by ICARDA (International Center of Agriculture in Dry Areas), FAO and Bioversity International . It was created the leguminous plants (bean, cow pea, chickpea, horse bean, grass pea) databases by proper database management systems within the structure of Central Database (CDB) on PGR of Azerbaijan based on MS FoxPro. Evaluated samples were taken from the National Genebank collection by proper crop groups

Current and future threats and opportunities facing European crop wild relatives and landrace diversity

The approach of this priority crop wild relatives (CWR) and landraces (LR) conservation exercise was to use the skills and knowledge of 52 ECPGR in situ and on-farm conservation network members and other conference delegates, representing a broad European range of PGR-related academic, research and NGO organizations, to identify the short- and longer-term issues that are/will impact on European CW

Current and future threats and opportunities facing European crop wild relatives and landrace diversity

The approach of this priority crop wild relatives (CWR) and landraces (LR) conservation exercise was to use the skills and knowledge of 52 ECPGR in situ and on-farm conservation network members and other conference delegates, representing a broad European range of PGR-related academic, research and NGO organizations, to identify the short- and longer-term issues that are/will impact on European CW

First report of <em>Barley yellow dwarf virus</em> and <em>Cereal yellow dwarf virus</em> affecting cereal crops in Azerbaijan

International audienceA field survey was conducted during the 2010/2011 growing season at the Absheron experimental station of the Genetic Resources Institute of Azerbaijan. A total of 49 cereal samples with yellowing and reddening symptoms were obtained from 12 bread wheats (Triticum aestivum), 25 durum wheats (T. durum), 11 wild or cultivated wheat relatives (T. dicoccoides, T. beoticum, T. monococcum, and T. turgidum), and one oat (Avena sativa). Samples were tested by tissue-blot immunoassay (2) using antisera against 7 cereal-infecting viruses: Barley stripe mosaic virus (BSMV), Wheat dwarf virus (WDV), Wheat streak mosaic virus (WSMV), Barley yellow mosaic virus (BaYMV), Barley yellow striate mosaic virus (BYSMV), Maize streak virus (MSV), and Barley yellow dwarf virus (BYDV). Strong positive reactions against the BYDV-PAV polyclonal antiserum were shown by 43 samples. To confirm, total RNAs from 10 of the positive samples (three bread wheat, three durum wheat, the oat, and one sample each of T. beoticum, T. turgidum, and T. dicoccoides) were submitted to RT-PCR with two primer pairs adapted in part from (3). Primers Luteo1F 5′TTCGGMSARTGGTTGTGGTCCA 3′ and YanR-new 5′TGTTGAGGAGTCTACCTATTTNG 3′ (adapted from primer YanR (3)) allow the specific amplification of viruses of the genus Luteovirus (including BYDV) while primers Luteo2F 5′TCACSTTCGGRCCGWSTYTWTCAG 3′ (adapted from primer Shu2a-F (3)) and YanR-new are specific for the genus Polerovirus (including Cereal yellow dwarf virus, CYDV). All 10 tested samples gave a positive amplification at the expected size (~545 bp) with the first primer pair, while only two samples, one from oat and one from the wild wheat relative T. dicoccoides, gave a positive amplification of the expected size (~383 bp) with the second primer pair. Sequencing of amplification products obtained with the Luteo1F/YanR-new primer pair confirmed the presence of BYDV-PAV in all samples (GenBank JX275850 to JX275857). The Azeri isolates were all similar (0 to 1.7% nucleotide divergence) except for one isolate (JX275855, from T. turgidum, 2.4 to 3.2% divergence). An Azeri BYDV-PAV isolate (JX275851, from bread wheat) showed 100% identity with a Latvian isolate (AJ563414) and with two isolates from Morocco (AJ007929 and AJ007918). These isolates belong to a group of widespread PAV isolates and are 99% identical with isolates from Sweden, the United States, China, France, and New Zealand. Sequencing of products obtained with the Luteo2F/YanR-new primers (JX294311 and JX294312) identified CYDV-RPV. The two Azeri sequences show ~3% nucleotide divergence and their closest relatives in GenBank are a range of CYDV-RPV isolates mostly from the United States, including EF521848 and EF521830, with ~4 to 5% divergence. Presence of CYDV was also confirmed using amplification with a CYD-specific primer pair (CYDV-fw-New 5′TTGTACCGCTTGATCCACGG 3′ et CYDV-rev-New 5′GTCTGCGCGAACCATTGCC 3′, both adapted from (1)) and sequencing of the amplification products. This is, to our knowledge, the first report of BYDV-PAV and CYDV-RPV infecting cultivated cereals and wild or cultivated wheat relatives in Azerbaijan. These viruses are responsible for serious disease losses in cereal crops worldwide (4). Their full impact on crops in Azerbaijan is yet to be seen

Investigation of genetic diversity of wheat genotypes (Triticum aestivum L.) using microsatellite markers

The study was devoted to evaluate genetic diversity of 48 winter wheat genotypes (varieties and advanced lines) with different origins using simple sequence repeat (SSR) markers/ Out of 20 SSR primer pairs used for assessing the genetic diversity, 19 primer pairs were polymorphic. Microsatellite PIC values ranged from 0.26 to 0.93 with an average value of 0.740. The cluster analysis based on Nei genetic distance indices divided genotypes into four main groups/ The Xwmc24, Xwmc169, Xgpw322, Xgwm297 and Xbarc267 primers amplified high number of alleles, showing relatively high level of polymorphism and evaluated as efficient primers for genetic diversity analysis of wheat populations

Adapting Agriculture to Climate Change: A Synopsis of Coordinated National CropWild Relative Seed Collecting Programs across Five Continents

The Adapting Agriculture to Climate Change Project set out to improve the diversity, quantity, and accessibility of germplasm collections of crop wild relatives (CWR). Between 2013 and 2018, partners in 25 countries, heirs to the globetrotting legacy of Nikolai Vavilov, undertook seed collecting expeditions targeting CWR of 28 crops of global significance for agriculture. Here, we describe the implementation of the 25 national collecting programs and present the key results. A total of 4587 unique seed samples from at least 355 CWR taxa were collected, conserved ex situ, safety duplicated in national and international genebanks, and made available through the Multilateral System (MLS) of the International Treaty on Plant Genetic Resources for Food and Agriculture (Plant Treaty). Collections of CWR were made for all 28 targeted crops. Potato and eggplant were the most collected genepools, although the greatest number of primary genepool collections were made for rice. Overall, alfalfa, Bambara groundnut, grass pea and wheat were the genepools for which targets were best achieved. Several of the newly collected samples have already been used in pre-breeding programs to adapt crops to future challenges

Adapting Agriculture to Climate Change: A Synopsis of Coordinated National Crop Wild Relative Seed Collecting Programs across Five Continents

The Adapting Agriculture to Climate Change Project set out to improve the diversity, quantity, and accessibility of germplasm collections of crop wild relatives (CWR). Between 2013 and 2018, partners in 25 countries, heirs to the globetrotting legacy of Nikolai Vavilov, undertook seed collecting expeditions targeting CWR of 28 crops of global significance for agriculture. Here, we describe the implementation of the 25 national collecting programs and present the key results. A total of 4587 unique seed samples from at least 355 CWR taxa were collected, conserved ex situ, safety duplicated in national and international genebanks, and made available through the Multilateral System (MLS) of the International Treaty on Plant Genetic Resources for Food and Agriculture (Plant Treaty). Collections of CWR were made for all 28 targeted crops. Potato and eggplant were the most collected genepools, although the greatest number of primary genepool collections were made for rice. Overall, alfalfa, Bambara groundnut, grass pea and wheat were the genepools for which targets were best achieved. Several of the newly collected samples have already been used in pre-breeding programs to adapt crops to future challenges.info:eu-repo/semantics/publishedVersio