24,506 research outputs found
Recommended from our members
Previously Identified Genetic Variants in ADGRL3 Are not Associated with Risk for Equine Degenerative Myeloencephalopathy across Breeds.
Equine neuroaxonal dystrophy/equine degenerative myeloencephalopathy (eNAD/EDM) is a neurologic disease that has been reported in young horses from a wide range of breeds. The disease is inherited and associated with vitamin E deficiency during the first two years of life, resulting in bilateral symmetric ataxia. A missense mutation (chr3:71,917,591 C > T) within adhesion G protein-coupled receptor L3 (ADGRL3) was recently associated with risk for EDM in the Caspian breed. In order to confirm these findings, genotyping of this missense mutation, along with the three other associated single nucleotide polymorphisms (SNPs) in the genomic region, was carried out on 31 postmortem-confirmed eNAD/EDM cases and 43 clinically phenotyped controls from various breeds. No significant association was found between eNAD/EDM confirmed cases and genotype at any of the four identified SNPs (P > 0.05), including the nonsynonymous variant (EquCab2.0 chr3:71,917,591; allelic P = 0.85). These findings suggest that the four SNPs, including the missense variant in the ADGRL3 region, are not associated with risk for eNAD/EDM across multiple breeds of horses
Recommended from our members
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed
The Kelvin Formula for Thermopower
Thermoelectrics are important in physics, engineering, and material science
due to their useful applications and inherent theoretical difficulty,
especially in strongly correlated materials. Here we reexamine the framework
for calculating the thermopower, inspired by ideas of Lord Kelvin from 1854. We
find an approximate but concise expression, which we term as the Kelvin formula
for the the Seebeck coefficient. According to this formula, the Seebeck
coefficient is given as the particle number derivative of the entropy
, at constant volume and temperature ,
. This formula is shown to be competitive compared to other
approximations in various contexts including strongly correlated systems. We
finally connect to a recent thermopower calculation for non-Abelian fractional
quantum Hall states, where we point out that the Kelvin formula is exact.Comment: 6 pages, 2 figure
16S rRNA gene profiling and genome reconstruction reveal community metabolic interactions and prebiotic potential of medicinal herbs used in neurodegenerative disease and as nootropics.
The prebiotic potential of nervine herbal medicines has been scarcely studied. We therefore used anaerobic human fecal cultivation to investigate whether medicinal herbs commonly used as treatment in neurological health and disease in Ayurveda and other traditional systems of medicine modulate gut microbiota. Profiling of fecal cultures supplemented with either Kapikacchu, Gotu Kola, Bacopa/Brahmi, Shankhapushpi, Boswellia/Frankincense, Jatamansi, Bhringaraj, Guduchi, Ashwagandha or Shatavari by 16S rRNA sequencing revealed profound changes in diverse taxa. Principal coordinate analysis highlights that each herb drives the formation of unique microbial communities predicted to display unique metabolic potential. The relative abundance of approximately one-third of the 243 enumerated species was altered by all herbs. Additional species were impacted in an herb-specific manner. In this study, we combine genome reconstruction of sugar utilization and short chain fatty acid (SCFA) pathways encoded in the genomes of 216 profiled taxa with monosaccharide composition analysis of each medicinal herb by quantitative mass spectrometry to enhance the interpretation of resulting microbial communities and discern potential drivers of microbiota restructuring. Collectively, our results indicate that gut microbiota engage in both protein and glycan catabolism, providing amino acid and sugar substrates that are consumed by fermentative species. We identified taxa that are efficient amino acid fermenters and those capable of both amino acid and sugar fermentation. Herb-induced microbial communities are predicted to alter the relative abundance of taxa encoding SCFA (butyrate and propionate) pathways. Co-occurrence network analyses identified a large number of taxa pairs in medicinal herb cultures. Some of these pairs displayed related culture growth relationships in replicate cultures highlighting potential functional interactions among medicinal herb-induced taxa
An absorption spectrum amplifier for determining gas composition
Compositions of gas samples are frequently studied by laser absorption spectroscopy. Sensitivity is improved by two orders of magnitude when absorption cell is placed inside an organic-dye laser cavity
Strong Optomechanical Squeezing of Light
We create squeezed light by exploiting the quantum nature of the mechanical
interaction between laser light and a membrane mechanical resonator embedded in
an optical cavity. The radiation pressure shot noise (fluctuating optical force
from quantum laser amplitude noise) induces resonator motion well above that of
thermally driven motion. This motion imprints a phase shift on the laser light,
hence correlating the amplitude and phase noise, a consequence of which is
optical squeezing. We experimentally demonstrate strong and continuous
optomechanical squeezing of 1.7 +/- 0.2 dB below the shot noise level. The peak
level of squeezing measured near the mechanical resonance is well described by
a model whose parameters are independently calibrated and that includes thermal
motion of the membrane with no other classical noise sources.Comment: 12 pages, 8 figure
Optical to Near-IR Spectrum of a Massive Evolved Galaxy at z = 1.26
We present the optical to near-infrared (IR) spectrum of the galaxy TSPS
J1329-0957, a red and bright member of the class of extremely red objects
(EROs) at z = 1.26. This galaxy was found in the course of the Tokyo-Stromlo
Photometry Survey (TSPS) which we are conducting in the southern sky. The
spectroscopic observations were carried out with the Gemini Multi-Object
Spectrograph (GMOS) and the Gemini Near Infra-Red Spectrograph (GNIRS) mounted
on the Gemini-South telescope. The wide wavelength coverage of 0.6 - 2.3 um
provides useful clues as to the nature of EROs while most published spectra are
limited to a narrower spectral range which is dictated by the need for
efficient redshift determination in a large survey. We compare our spectrum
with several optical composite spectra obtained in recent large surveys, and
with stellar population synthesis models. The effectiveness of using near-IR
broad-band data, instead of the spectral data, in deriving the galaxy
properties are also investigated. We find that TSPS J1329-0957 formed when the
universe was 2 - 3 Gyr old, and subsequently evolved passively to become one of
the most massive galaxies found in the z = 1 - 2 universe. Its early type and
estimated stellar mass of M* = 10^{11.5} Msun clearly point to this galaxy
being a direct ancestor of the brightest elliptical and spheroidal galaxies in
the local universe.Comment: 18 pages, 4 figures. Accepted for publication in Ap
- …