First detection of tomato leaf curl New Delhi virus in melon and zucchini squash in southern Italy

In September 2017, severe symptoms and heavy infestations of aleyrodids were reported on cucurbit crops grown in open fields at the border between Apulia and Basilicata regions (southern Italy). In zucchini squash symptoms consisted in severe curling and brittle fracture of the leaves. Melon plants showed bright yellow mosaic on leaves and necrotic streaks along the stems, flower stalks and fruits whereas squash plants displayed severe yellow mosaic and leaf blade deformation. Disease incidence in the three crops was close to 100%. Symptoms resembled those described recently for infections of tomato leaf curl New Delhi virus (ToLCNDV) (Panno et al., 2016) and watermelon mosaic virus (WMV) (Finetti- Sialer et al., 2012). DNA and RNA preparations from two plants for each species were tested by PCR, respectively, with primers For-5’CCCTTGTAAAGTGCAGTCCT3’ and Rev- 5’GGATTTGATGCGTGAGTACA3’ for the AV1 gene of ToLCNDV DNA-A and with primers For-5’AAACTGGG CAGGGTAGCA3’ and Rev-5’TAACCTGCTGTTAA YCCCGCG3’ for the WMV coat protein gene. Samples of melon and zucchini proved positive for ToLCNDV whereas WMV was detected in squash. No amplification products were obtained with primers for squash leaf curl virus, watermelon chlorotic spot virus, cucumber mosaic virus, cucumber vein yellowing virus and zucchini yellow mosaic virus. Amplicon identities were confirmed by sequencing. Those from zucchini and melon showed 100% identity with ToLCNDV from Spain (KF749224) and Sicily (KU145141) whereas those from squash were 99% and 94% identical to WMV from Belgium (KP980663) and Italy (FJ8231229), respectively. The sequence of a 507 bp fragment of ToLCNDV was deposited in GenBank under the accession number MG269826. This is the first report of ToLCNDV in melon and in the continental part of the Country

Modélisation du grenaillage de précontrainte via l'analyse dimensionnelle : du profil de contrainte vers la pièce déformé

Le Grenaillage est un procédé de traitement mécaniquede surface, qui consiste à bombarder la surface du matériau avec des billes projetées à différentes vitesses.L’impact provoque une déformation plastique et donc des contraintes résiduelles de compression en surface. L’objectif de cette étude est l’amélioration de la maîtrise du procède de grenaillage et de prévoir la distribution de contraintes résiduelles après grenaillageà l’aide d’un modèle conçu grâce à l’analyse dimensionnelle. Les contraintes résiduelles dépendent des propriétés physiques des billes et du matériau traité, des conditions du procédé etc, et ces paramètres sont prisen compte dans le modèle. Une comparaison entre les profils de contrainte modélisés et des profils expérimentaux est proposée afin de tester leur fiabilité. Pour simuler le grenaillage sur des pièces complexes nous proposons de calculer le profil de contrainte avec le modèle et de l’introduire ensuite dans un modèle éléments finis de la pièce complexe qui fournira, après calcul, l’état de contraintes et déformations sur toute la pièce. La possibilité d’utiliser un modèle dynamique des billes qui permet de simuler le grenaillage ultrason (GUS) et de fournir la distribution des vitesses d’impact permet l’utilisation de ce modèle pour le GUS. La prise en compte du profil de contrainte résiduelle dans le dimensionnement d’une pièce est extrêmement importante. L’avantage du modèle proposé est sa rapidité d’exécution, et la simplicité du passage entre les profils de contrainte modélisés à la pièce déformé à l’aide d’un code FEM et avec un calcul de rééquilibrage statique. Les futures développements concernentles méthodes d’introduction des contraintes afin d’effectuer des calculs sur des pièces à géométrie de plus en plus complexes

Infection Cycle of Artichoke Italian Latent Virus in Tobacco Plants : Meristem Invasion and Recovery from Disease Symptoms

Peer reviewe

Simulation of shot peening: From process parameters to residual stress fields in a structure

Manufacturing industries perform mechanical surface treatments like shot peening at the end of the manufacturing chain to protect important working parts. This treatment modifies the near surface of the treated part with the introduction of compressive residual stresses due to the repeated impacts of the shot. Then, the treated part exhibits, not only a longer life, but also a better fretting behavior, an improved resistance to corrosion… The objective of the present paper is first to study the relation between the process parameters and the material state (residual stress and plastic variables…) for a complex geometry. Next, a numerical tool is proposed, able to predict this material state in a time frame that is consistent with industrial constraints. The originality of the proposed approach thus consists in the chaining of the different steps. The first step is to choose the process parameters for the shot peening process considering conventional or ultrasonic shot peening and model the shot dynamics for a complex geometry. Once the impact velocity field is known, the objective is to compute the local incompatible plastic deformation field due to the repeated impacts using analytical methods. Then, a finite element model is used to compute the residual and deformation fields in the considered mechanical part. The complete method has been performed on the model of a gear, a mechanical part that is most often shot peened and exhibits a complex geometry

ICTV Virus Taxonomy Profile: Bromoviridae

[EN] Bromoviridae is a family of plant viruses with tri-segmented, positive-sense, single-stranded RNA genomes of about 8 kb in total. Genomic RNAs are packaged in separate virions that may also contain subgenomic, defective or satellite RNAs. Virions are variable in morphology (spherical or bacilliform) and are transmitted between hosts mechanically, in/on the pollen and non-persistently by insect vectors. Members of the family are responsible for major disease epidemics in fruit, vegetable and fodder crops such as tomato, cucurbits, bananas, fruit trees and alfalfa. This is a summary of the International Committee on Taxonomy of Viruses (ICTV) Report on the family Bromoviridae, which is available at www.ictv.global/report/bromoviridae.Production of this summary, the online chapter and associated resources was funded by a grant from the Wellcome Trust (WT108418AIA). Members of the ICTV (10th) Report Consortium are Elliot J. Lefkowitz, Andrew J. Davison, Stuart G. Siddell, Peter Simmonds, Sead Sabanadzovic, Donald B. Smith, Richard J. Orton and F. Murilo Zerbini.Bujarski, J.; Gallitelli, D.; Garcia, F.; Pallás Benet, V.; Palukaitis, P.; Reddy, M.; Wang, A.... (2019). ICTV Virus Taxonomy Profile: Bromoviridae. Journal of General Virology. 100(8):1206-1207. https://doi.org/10.1099/jgv.0.001282S120612071008Pallas, V., Aparicio, F., Herranz, M. C., Sanchez-Navarro, J. A., & Scott, S. W. (2013). The Molecular Biology of Ilarviruses. Advances in Virus Research, 139-181. doi:10.1016/b978-0-12-407698-3.00005-3Hanssen, I. M., & Lapidot, M. (2012). Major Tomato Viruses in the Mediterranean Basin. Viruses and Virus Diseases of Vegetables in the Mediterranean Basin, 31-66. doi:10.1016/b978-0-12-394314-9.00002-6Jacquemond, M. (2012). Cucumber Mosaic Virus. Viruses and Virus Diseases of Vegetables in the Mediterranean Basin, 439-504. doi:10.1016/b978-0-12-394314-9.00013-0Pallas, V., Aparicio, F., Herranz, M. C., Amari, K., Sanchez-Pina, M. A., Myrta, A., & Sanchez-Navarro, J. A. (2012). Ilarviruses of Prunus spp.: A Continued Concern for Fruit Trees. Phytopathology®, 102(12), 1108-1120. doi:10.1094/phyto-02-12-0023-rv

Traitements de surface mécaniques : modélisation et caractérisations expérimentales

Mechanical surface treatments are widely used in manufacturing industries in order to improve mechanical properties of materials. Among them, shot peening is certainly the most known, even if ultrasonic shot peening and laser shock peening are becoming more and more common. This work consists in a large study of shot peening, divided in three parts.The first one is focused on the conception of a semi analytical model for residual stress prediction after conventional shot peening or ultrasonic shot peening. An approach able to chain the whole shot peening process, starting from process parameters to residual stress field in a structure is proposed. Several numerical simulations of shot-body impacts are carried out in order to determine the parameters of the model.In the second part of this work, a characterization of the ultrasonic shot peening process is performed thanks to many experimental measurements and shot dynamic simulations.The last part of this PhD work corresponds to an experimental analysis focused on the combination of ultrasonic shot peeing with gas nitriding on a martensitic steel. A comparison between ultrasonic shot peening, conventional shot peeing and laser shock peening effects is finally proposedLes traitements de surface occupent une place très importante au niveau industriel, visant à améliorer les propriétés mécaniques des matériaux. Parmi eux, le grenaillage de précontrainte (GC) est certainement le plus renommé, même si le grenaillage ultrasonore (GUS) et le choc laser (LSP) sont de plus en plus présents. Ce travail consiste en une étude approfondie du grenaillage qui peut être divisée en trois parties. La première partie propose un modèle semi analytique pour la prédiction des contraintes résiduelles après grenaillage conventionnel ou ultrasonore. Une démarche permettant d’obtenir la déformation d’une pièce à géométrie complexe à partir des paramètres du procède de grenaillage conventionnel ou ultrasonore a été mise en place. Plusieurs simulations numériques d’impacts bille-massif ont été réalisées dans l’objectif de choisir les variables à prendre en compte dans le modèle proposé. Dans une deuxième partie, plusieurs séries de mesures expérimentales et de simulations numériques de la dynamique des billes ont été réalisées afin de permettre une optimisation et une meilleure compréhension du GUS. Dans la dernière partie de ce travail, un grand nombre de mesures expérimentales ont été menées afin d’étudier le couplage entre le grenaillage ultrasonore et la nitruration gazeuse d’un acier martensitique. Enfin, une comparaison entre le grenaillage ultrasonore, conventionnel et le choc laser est proposé

The ecology of Cucumber mosaic virus and sustainable agriculture

An account is given of the ecology of Cucumber mosaic virus (CMV) as a pertinent example of how a virus can affect the sustainability of an important crop. It is now generally accepted that the technologies used in modern agriculture should ensure that production systems are operated in such a way that the quality of the produce is maintained year after year without causing degradation of the environment. Recent experiences in countries of the Mediterranean basin demonstrate that the benefits expected from the introduction of new and highly productive plant varieties may be quickly eroded by the concomitant introduction of new virus strains which can greatly change the structure of the resident virus population. Quarantine inspection of plant propagules and genetic engineering are suggested as powerful tools to help achieve sustainability. (C) 2000 Elsevier Science B.V. All rights reserved