Extension of the crRNA enhances Cpf1 gene editing in vitro and in vivo.

Engineering of the Cpf1 crRNA has the potential to enhance its gene editing efficiency and non-viral delivery to cells. Here, we demonstrate that extending the length of its crRNA at the 5 end can enhance the gene editing efficiency of Cpf1 both in cells and in vivo. Extending the 5 end of the crRNA enhances the gene editing efficiency of the Cpf1 RNP to induce non-homologous end-joining and homology-directed repair using electroporation in cells. Additionally, chemical modifications on the extended 5 end of the crRNA result in enhanced serum stability. Also, extending the 5 end of the crRNA by 59 nucleotides increases the delivery efficiency of Cpf1 RNP in cells and in vivo cationic delivery vehicles including polymer nanoparticle. Thus, 5 extension and chemical modification of the Cpf1 crRNA is an effective method for enhancing the gene editing efficiency of Cpf1 and its delivery in vivo

Differential Regulation of the Cell-Surface Targeting and Function of ␤-and ␣ 1 -Adrenergic Receptors by Rab1 GTPase in Cardiac Myocytes

ABSTRACT The molecular mechanism underlying the export from the endoplasmic reticulum (ER) to the cell surface and its role in the regulation of signaling of adrenergic receptors (ARs) remain largely unknown. In this report, we determined the role of Rab1, a Ras-like GTPase that coordinates protein transport specifically from the ER to the Golgi, in the cell surface targeting and function of endogenous ␤-and ␣ 1 -ARs in neonatal rat ventricular myocytes. Adenovirus-driven expression of Rab1 into myocytes selectively increased the cell-surface number of ␣ 1 -AR, but not ␤-AR, whereas the dominant-negative mutant Rab1N124I significantly reduced the cell-surface expression of ␤-AR and ␣ 1 -AR. Brefeldin A inhibited ␤-AR and ␣ 1 -AR export and antagonized the Rab1 effect on ␣ 1 -AR expression. Manipulation of Rab1 function similarly influenced the transport of ␣ 1A -and ␣ 1B -ARs as well as ␤ 1 -and ␤ 2 -ARs. Fluorescent microscopy analysis demonstrated that expression of Rab1N124I and Rab1 small interfering RNA induced a marked accumulation of GFP-tagged ␤ 2 -AR and ␣ 1B -AR in the ER. Consistent with the effects on receptor cell-surface targeting, Rab1 selectively enhanced ERK1/2 activation and hypertrophic growth in response to the ␣ 1 -AR agonist phenylephrine but not to the ␤-AR agonist isoproterenol. Rab1N124I inhibited both agonist-mediated ERK1/2 activation and hypertrophic growth in neonatal myocytes. These results demonstrate that the cellsurface targeting and signaling of ␤-and ␣ 1 -ARs require Rab1 and are differentially modulated by augmentation of Rab1 function. Our data provide strong evidence implicating the ER-toGolgi traffic as a site for selective manipulation of distinct AR function in cardiac myocytes

Immune-modulation of two BATF3 paralogues in rainbow trout Oncorhynchus mykiss

This work was supported by the Royal Society of Edinburgh and the National Natural Science Foundation of China (Grant Nos., 31511130137 and 31372568). Dr Jun Wang’s visit to the Scottish Fish Immunology Research Centre was funded by the China Scholarship Council (CSC).Peer reviewedPostprin

Enhancement of the recycling and activation of β-adrenergic receptor by Rab4 GTPase in cardiac myocytes,”

Abstract We investigate the role of Rab4, a Ras-like small GTPase coordinating protein transport from the endosome to the plasma membrane, on the recycling and activation of endogenous β-adrenergic receptor (β-AR) in HL-1 cardiac myocytes in vitro and transgenic mouse hearts in vivo. β 1 -AR, the predominant subtype of β-AR in HL-1 cardiac myocytes, was internalized after stimulation with isoproterenol (ISO) and fully recycled at 4 h upon ISO removal. Transient expression of Rab4 markedly facilitated recycling of internalized β-AR to the cell surface and enhanced β-AR signaling as measured by ISO-stimulated cAMP production. Transgenic overexpression of Rab4 in the mouse myocardium significantly increased the number of β-AR in the plasma membrane and augmented cAMP production at the basal level and in response to ISO stimulation. Rab4 overexpression induced concentric cardiac hypertrophy with a moderate increase in ventricle/body weight ratio and posterior wall thickness and a selective up-regulation of the β-myosin heavy chain gene. These data provide the first evidence indicating that Rab4 is a rate-limiting factor for the recycling of endogenous β-AR and augmentation of Rab4-mediated traffic enhances β-AR function in cardiac myocytes. β-Adrenergic receptors (ARs) 2 are members of the seven transmembrane spanning G proteincoupled receptor (GPCR) family and play a critical role in the regulation of cardiac function in response to cate-cholamine stimulation (1-3). Three subtypes, β 1 -AR, β 2 -AR, and β 3 -AR, have been identified in the mammalian hearts. β 1 -AR and β 2 -AR are major mediators of cardiac contractility through coupling to heterotrimeric G proteins to regulate the activation of adenylyl cyclases, which in turn modulates production of intracellular cAMP and activation of protein kinase A. β 1 -AR couples to the stimulatory G protein Gs, whereas β 2 -AR couples to both G s and the inhibitory G protein G i NIH Public Access Rab proteins are Ras-like small GTPases that regulate vesicular protein transport in both endocytosis and exocytosis (6, In this report, we investigated the effect of augmentation of Rab4 function on the recycling and activation of endogenous β-AR in both cardiac myocytes in vitro and mouse hearts in vivo. Our data demonstrated that increased wild-type Rab4 expression facilitated recycling to the plasma membrane and signaling of β-AR in cultured HL-1 cardiac myocytes. Our results also showed that cardiac specific overexpression of wild-type Rab4 augmented the membrane targeting and function of β-AR. Furthermore, overexpression of wild-type Rab4 induced cardiac hypertrophy with preserved contractile function. These data provide the first evidence indicating that endogenous Rab4 expression level is a rate-limiting factor for the recycling of endogenous β-AR and that augmentation of Rab4-mediated traffic enhances β-AR function in cardiac myocytes. EXPERIMENTAL PROCEDURES Materials Antibodies against Rab1, Rab4, Rab5, G s , G i , Gβ, GRK2, and calregulin were purchased from Santa Cruz Biotechnology, Inc. Anti-GM130 antibody was from BD Transduction Laboratories. Antibody against Na + -K + -ATPase was from Affinity Bio-Reagents (Golden, CO Ci/mmol) and [ 3 H]CGP12177 (specific activity = 51 Ci/mmol) were from Amersham Biosciences. All other materials were obtained as described elsewhere Culture and Transfection of HL-1 Cardiomyocytes HL-1 myocytes were plated onto 12-well plates at a density of 4 × 10 5 cells/well and cultured in Claycomb medium supplemented with 10% fetal bovine serum, 100 units/ml penicillin, 100 μg/ml streptomycin, 0.1 mM norepinephrine, and 2 mM L-glutamine as described previously (23). Rab4 was tagged with FLAG epitope at the amino terminus of Rab4 (FLAG-Rab4) by PCR using a primer GACTACAAGGACGACGATGACAAG coding a peptide DYKDDDDK. The FLAG epitope has been used to label a number of proteins resulting in tagged-proteins with similar characteristics to their respective wild-types (24). After 24-h culture without norepinephrine, HL-1 myocytes were transiently transfected with 2 μg of Rab4 or the pcDNA3 vector using Lipofectamine 2000 reagent (Invitrogen) as described previously (23). Ligand Binding in Intact HL-1 Cardiomyocytes Intact cell ligand binding was used to measure cell surface expression of β-AR. HL-1 myocytes were cultured on 12-well plates and incubated with [ 3 H]CGP12177 at a concentration of 20 nM for 2 h at room temperature. To measure the expression of β 1 -AR and β 2 -AR subtypes, the HL-1 cells were preincubated with the β 1 -AR-selective antagonist atenolol (20 μM) or the β 2 -AR-selective antagonist ICI118,551 (20 μM) for 30 min. The nonspecific binding was determined in the presence of alprenolol (20 μM). After washing twice with ice-cold phosphatebuffered saline (1 ml each time), the cells were digested with 1 ml of 1 M NaOH. The radioactivity was counted by liquid scintillation spectrometry in 5 ml of Ecoscint A scintillation solution (National Diagnostics, Inc., Atlanta, GA). Measurement of β-AR Internalization and Recycling in HL-1 Myocytes β-AR internalization in response to stimulation with ISO and recycling of internalized receptors were determined as essentially described (9,12) with modifications. Briefly, HL-1 myocytes were cultured on 12-well plates and transfected as described above. At 48 h after transfection, the cells were incubated with ISO at a concentration of 10 μM for different times at 37 °C to initiate receptor internalization. The cells were washed twice with 1 ml of ice-cold Dulbecco's modified Eagle's medium to remove ISO and allowed to recover for different time periods (from 15 to 240 min). β-AR expression at the cell surface was then determined by ligand binding as described above. Generation of Rab4 Transgenic Mice Transgenic mice overexpressing Rab4 in the myocardium were generated essentially as described (21). The cDNA encoding FLAG-Rab4 was cloned into exon three of the full-length mouse α-myosin heavy chain (MHC) promoter (21). The entire 7.7-kb transgene fragment containing the entire α-MHC promoter, the complete FLAG-Rab4 cDNA, and a human growth hormone polyadenylation signal sequence was released from the plasmid backbone by digestion with BamHI and was used for microinjection into pronuclei of fertilized mouse oocytes (FVB/N background) using standard techniques (Pennington Biomedical Research Institute, Louisiana State University, Baton Rouge, LA). Transgenic mice were identified by Southern blot or PCR analysis using genomic DNA extracted from mouse tails. All studies were performed in Rab4 transgenic mice and nontransgenic (NTG) siblings at 22 weeks old in accordance with protocols approved by the Louisiana State University Health Sciences Center Institutional Animal Care and Use Committee. Measurement of Cardiac β-AR Expression β-AR density was measured as described Measurement of cAMP Production cAMP production in response to stimulation with ISO or forskolin was measured in the presence of 3-isobutyl-1-methylxanthine (0.5 mM), a phosphodiesterase inhibitor, by using cAMP enzymeimmunoassay system (Biotrak, Amersham Biosciences) as described (26). For measurement of cAMP production by membrane fractions prepared from NTG and Rab4 transgenic mouse ventricles, an aliquot of membrane fraction (about 0.8 μg of protein) was transferred into microtiter plates and then incubated with anti-cAMP antiserum, followed by the incubation with cAMP-peroxidase. After washing and addition of substrate, peroxidase activity was measured by spectrometry. cAMP concentrations were calculated based on the competition of cAMP in samples with a fixed quantity of peroxidase-labeled cAMP. For measurement of cAMP production in cultured cardiomyocytes, HL-1 cells were cultured in 12-well plates and transfected with 2 μg of Rab4 or pcDNA3 as described above. After 48 h, the cells were stimulated with increasing concentrations of ISO (from 10 −9 to 10 −5 M) or forskolin (100 μM) for 10 min at room temperature. The reactions were stopped by aspirating the medium and then the cells were lysed using 200 μl of dodecyltrimethylammonium (2.5%). One-hundred μl of cell lysate was used to determine cAMP concentration as described above. Measurement of Cardiac Hypertrophy Morphometric analysis and histological examination of Masson's trichrome-and hematoxylineosin-stained ventricles used standard techniques as described previously (21). Cardiac gene expression was assayed by RNA dot blot analysis using total RNA (3 μg/dot) extracted from ventricles of NTG and transgenic mice and 32 P-labeled oligonucleotides as probes (21,27). Radiolabeled RNA dots were quantitated with a PhosphorImager (Amersham Biosciences), and expression of each cardiac gene was normalized to glyceraldehyde-3-phosphate dehydrogenase expression. Echocardiography Mice were anesthetized with avertin (250 mg/kg, intraperitoneal). Cardiac ultrasound studies were performed on Rab4 transgenic mice and NTG sibling controls at 22 weeks old using a SSA770 Aplio Ultrasound system (Toshiba America Medical Systems, Tustin, CA) with a 1204AX linear array transducer scanning at 14 MHz center frequency. Depth setting was 2 cm with a 0.75-cm electronic focus and two-dimensional imaging frame rate of 238 Hz. Twodimensional guided M-mode studies of the left ventricle at the level of the papillary muscles were performed. M-mode measurements were made using the leading-edge to leading-edge Immunoblot Analysis Western blot analysis of protein expression was carried out as described previously (22,23). Proteins were separated by SDS-PAGE and transferred onto polyvinylidene difluoride membranes. The signal was detected using ECL Reagent Plus (PerkinElmer Life Sciences, Boston, MA) with a Fujifilm Luminescent Image Analyzer (LAS-1000plus) and quantitated using Image Gauge Program (Version 3.4). Protein loading and transfer efficiency were evaluated by Amido Black staining of the membrane after immunoblotting. Statistical Analysis Data are expressed as the mean ± S.E. Differences were evaluated using Student's t test. p < 0.05 was considered as statistically significant. RESULTS Effect of Transient Expression of Rab4 on the Recycling of Internalized β-AR in HL-1 Cardiomyocytes To determine whether Rab4 is involved in the regulation of endogenous β-AR recycling in cardiac myocytes, we choose HL-1 cardiomyocytes, an immortal cardiac muscle cell line that proliferates and retains phenotypic characteristics of cardiomyocytes Internalization of β-AR in response to stimulation with ISO in HL-1 cardiac myocytes was then characterized. ISO stimulation induced internalization of plasma membrane β-AR in a time-and dose-dependent manner In the next series of experiments we determined whether increased Rab4 function could modulate the recycling of internalized β-AR in HL-1 myocytes. HL-1 myocytes were transiently transfected with FLAG-tagged Rab4. Rab4 expression was then determined by Western blotting using FLAG high affinity monoclonal and Rab4 antibodies. The FLAG antibody detected only exogenously transfected Rab4, whereas the Rab4 antibody detected both transfected FLAG-Rab4 and endogenous Rab4. Rab4 expression was about four times higher in the FLAG-Rab4 transfected cells than endogenous Rab4 in cells transfected with the pcDNA3 vector ( NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript The HL-1 myocytes were treated by ISO for 30 min to initiate internalization and then allowed to recover for various period of time (15, 30, 60, 120, and 240 min). After 4 h, β-ARs were fully recycled back to the plasma membrane in myocytes transfected with the pcDNA3 vector Effect of Transient Expression of Rab4 on β-AR Signaling in HL-1 Cardiomyocytes To determine whether Rab4-faciliated recycling of internalized β-AR could modulate β-AR signaling, we measured the effect of transient expression of Rab4 on cAMP production in HL-1 cardiomyocytes. HL-1 myocytes were stimulated with increasing concentration of ISO (from 10 −9 to 10 −5 M) and intracellular cAMP concentrations were then measured. cAMP production in response to ISO stimulation at concentrations from 10 −8 to 10 −5 M was significantly higher in myocytes transfected with Rab4 than myocytes transfected with the pcDNA3 vector Effect of Transgenic Overexpression of Rab4 on β-AR Expression in the Plasma Membrane Preceding data indicate that increased Rab4 function facilitates recycling of internalized endogenous β-AR in cultured HL-1 myocytes. To determine whether increased Rab4 function could influence β-AR recycling in cardiac myocytes in vivo, we generated transgenic mice cardiac-specifically expressing FLAG-tagged Rab4. Transgenic mice were identified by Southern blot and PCR analyses of genomic DNA extracted from mouse tails. Rab4 expression in the ventricles of Rab4 transgenic and NTG mice was determined by Western blot analysis using anti-Rab4 and FLAG antibodies. Rab4 expression in transgenic mouse ventricles was increased by about 12-fold compared with NTG siblings We next determined whether Rab4 overexpression could alter the density of β-AR in the plasma membrane by radioligand binding. As β-AR are synthesized in the ER and transported to the plasma membrane through the Golgi apparatus, any contamination of the ER and/or the Golgi in the plasma membrane fractions would influence the actual number of the receptors in the plasma membrane. Thus, we first determined whether the plasma membrane preparations contained the ER and/or Golgi by measuring the expression of the ER marker calregulin, the Golgi marker GM130, and the plasma membrane marker Na + -K + -ATPase by immunoblotting. Both calregulin and GM130 were exclusively detected in the cytosolic fraction but not in the membrane fraction, whereas Na + -K + -ATPase was detected in the membrane fraction but not in the cytosolic fraction β-AR density was significantly increased in the membrane fraction from Rab4 transgenic mouse ventricles by 22% NIH-PA Author Manuscript NIH-PA Author Manuscript NIH-PA Author Manuscript β-AR density, expression of G s , G i , Gβ, and GRK2, molecules involved in the β-AR signaling, was not altered in Rab4 transgenic mice Effect of Transgenic Overexpression of Rab4 on β-AR Signaling We then determined whether enhanced Rab4 expression in the plasma membrane in vivo could activate β-AR signaling. cAMP production in response to stimulation with ISO was measured using membrane preparations from Rab4 transgenic and NTG mouse ventricles. Consistent with the increased β-AR density in the plasma membrane, ISO-stimulated cAMP production was significantly augmented by 3.3-fold in ventricles from Rab4 transgenic mice as compared with NTG controls Effect of Transgenic Overexpression of Rab4 on Cardiac Hypertrophy and Function The absolute heart and ventricle weights were significantly increased in Rab4 transgenic mice at 22 weeks old as compared with age-matched NTG controls (heart weight: NTG, 0.15 ± 0.01 and Rab4, 0.18 ± 0.01 g, n = 12, p < 0.05; ventricle weight: NTG, 0.13 ± 0.01 and Rab4, 0.16 ± 0.01 g, n = 12, p < 0.05). There was no difference in body weight between Rab4 transgenic and NTG mice (NTG, 32.4 ± 1.1 and Rab4, 31.2 ± 0.7 g), resulting in an increase in heart and ventricle weight-to-body weight ratio in the Rab4 mice Increased expression of cardiac fetal genes is associated with cardiac hypertrophy. To determine whether Rab4 overexpression-induced cardiac hypertrophy, as reflected by increased cardiac mass, is accompanied by an increased expression of hypertrophy-associated genes, we quantified the expression of atrial netriuretic peptide, β-MHC and α-skeletal actin by RNA dot blot. β-MHC expression normalized to the mRNA expression of glyceraldehyde-3-phosphate dehydrogenase was increased by 3.5-fold in Rab4 transgenic mouse hearts as compared with those from NTG mice In vivo M-mode echocardiography was used to determine the effect of Rab4 overexpression on left ventricular dimension at end-diastole (EDD) and end-systole (ESD) and posterior left ventricular wall thickness at end-diastole. Consistent with morphological and gravimetric data, posterior wall thickness in Rab4 transgenic mice was significantly increased by ~30% DISCUSSION Rab4 GTPase coordinates protein transport from the endosome to the plasma membrane The most important finding in this report is that Rab4 functions as a rate-limiting factor for the transport of endogenous β-AR to the plasma membrane. We first demonstrated that the recycling of β-AR after agonist stimulation was significantly facilitated by transient expression of wild-type Rab4 in HL-1 myocytes, in which β 1 -AR is the predominant subtype. To define whether Rab4 could enhance β-AR recycling in the mouse heart in vivo, we generated transgenic mice overexpressing Rab4 in the myocardium and determined the effect of increased Rab4 expression on the plasma membrane expression of β-AR. Chronic expression of Rab4 in the mouse heart moderately, but significantly, increased the density of β-AR in the plasma membrane. As the same numbers of HL-1 cells were used for transfection with control and Rab4 plasmids and the size of the myocytes from Rab4 transgenic mouse hearts were enlarged, it is likely that the receptor density is increased in each myocyte expressing wild-type Rab4. Rab4 expression did not alter β-AR expression at the cell surface before ISO stimulation and after complete recycling at 4 h, suggesting that Rab4 did not alter total β-AR expression. In contrast to the β-AR, expression of Rab1, Rab5, G s , G i , Gβ, and GRK2 was not affected by Rab4 expression, suggesting that altered Rab4 expression did not influence total protein synthesis. As Rab4 has been well demonstrated to regulate protein transport specifically from the endosomes to the plasma memebrane (6, To determine whether overexpression of Rab4 could regulate β-AR signaling as a consequence of modifying β-AR recycling, we measured ISO-stimulated cAMP production in HL-1 cardiomyocytes and in membrane preparations from Rab4 transgenic and NTG mouse hearts. cAMP production in HL-1 cells in response to stimulation at the highest concentration of ISO (10 −5 M) was doubled compared with the basal level. This increase is similar to the data obtained from human atrial membranes (30). As expected, the increased β-AR density in the plasma membrane led to increase in cAMP production after stimulation with ISO in both cultured myocytes and transgenic mouse hearts overexpressing Rab4. However, Rab4 expression had no effect on the cAMP production in response to forskolin stimulation, suggesting that increased cAMP production in response to ISO by Rab4 expression is not due to the alteration of adenylyl cyclase activity. In addition, Rab4 expression had no effect on the expression of other molecules involved in β-AR signal regulation, including G proteins and Filipeanu et al

Retinal Degeneration Caused by Rod-Specific Dhdds Ablation Occurs without Concomitant Inhibition of ProteinN-Glycosylation

Dehydrodolichyl diphosphate synthase (DHDDS) catalyzes the committed step indolichol synthesis. Recessive mutations inDHDDScause retinitis pigmentosa(RP59), resulting in blindness. We hypothesized that rod photoreceptor-specificablation ofDhddswould cause retinal degeneration due to diminished dolichol-dependent proteinN-glycosylation.Dhddsflx/flxmice were crossed with rod-spe-cific Cre recombinase-expressing (Rho-iCre75) mice to generate rod-specificDhddsknockout mice (Dhddsflx/flxiCre+).In vivomorphological and electrophys-iological evaluation ofDhddsflx/flxiCre+retinas revealed mild retinal dysfunctionat postnatal (PN) 4 weeks, compared with age-matched controls; however, rapidphotoreceptor degeneration ensued, resulting in almost complete loss of rodsand cones by PN 6 weeks. Retina dolichol levels were markedly decreased byPN 4 weeks inDhddsflx/flxiCre+mice, relative to controls; despite this,N-glycosyl-ation of retinal proteins, including opsin (the dominant rod-specific glycoprotein),persisted inDhddsflx/flxiCre+mice. These findings challenge the conventionalmechanistic view of RP59 as a congenital disorder of glycosylation

Cash flow risk in dual-channel supply chain

International audienceThis paper focuses on multi-period cash flow risk which is measured by the SD in dual-channel supply chain. The manufacturer offers a consignment contract to the retailer, exposing cash flow risk due to the payment delay. We analyze cash inflows, outflows, and netflows of each member in dual-channel supply chain. We also examine different influencing factors on the preference of cash flows in dual-channel supply chain and then provide some managerial implications to deal with cash flow risk

p Pickering emulsions stabilized by biocompatible particles: A review of preparation, bioapplication, and perspective

The phenomenon of adsorption of solid particles at fluid interfaces to stabilize emulsions or foams have been known for more than a century. Today, particle-stabilized emulsions, often referred to as Pickering emulsions, are receiving growing attention as they are encountered in oil recovery and have long been used in personal care products and food industry. Over the past 10 years the focus of the Pickering emulsion has also increasingly shifted to biomedical applications with thanks to novel syntheses of a wide range of biocompatible particle stabilizers. Here, a brief overview of the development of biocompatible particles is given for Pickering emulsion stabilization, including alginate, poly(lactic-co-glycolic acid) (PLGA), and protein-based particles. The materials prepared by templating from emulsion stabilized with biocompatible particles include colloidal capsules and hierarchically porous materials. It is hoped that the understanding gained from the recent intense activity in the field will enable more researchers to modify existing materials and design new formulations, which would be beneficial for exploring more biological applications. (c) 2021 Chinese Society of Particuology and Institute of Process Engineering, Chinese Academy of Sciences. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/)

Lateral inventory transshipment problem in online-to-offline supply chain

International audienceOnline-to-offline (OTO) is a new commercial model with enormous market potential. Online customer orders are forwarded to the offline brick-and-mortar store to fulfil, which is a combination of dual-channel supply chain. OTO overcomes many disadvantages of the traditional dual-channel supply chain, but still faces uncertain market demand. To reduce the inventory risk caused by demand uncertainty, lateral inventory transshipment is employed in this paper to pool inventory risk in OTO supply chain. We model centralised OTO and decentralised OTO with/without transshipment, and then analyse different scenarios. Our results demonstrate that there exists a unique Nash equilibrium of inventory order levels in dual channels and an optimal transshipment price to maximise the profit of the entire supply chain. Finally, we provide a numerical example of uniform demand distribution. Our analyses offer many managerial insights and show that transshipment always benefits the OTO supply chain