Structural Estimation of Variety Gains from Trade Integration in a Heterogeneous Firms Framework

The present paper structurally estimates the impact of increased variety in the EU and Asia over the period from 1989 to 2009. Using the most disaggregated import data available, we document that the number of varieties imported by the EU, defined as the number of import categories multiplied by the average number of source countries for each category, quadrupled, whereas it sextupled in Asia. About half of this increase was due to increases in the number of categories and half due to a doubling of the number of countries from which the EU and Asia imported each good. Using the Feenstra's (1994) methodology we estimate 35,000 elasticities and then construct an aggregate price index that is robust to common changes in quality variation, the arbitrary splitting of categories, the introduction of new goods, and other data problems. After reconstructing the EU and Asia import price indices, we found that the price of the EU imports has been falling at a rate 1.24 percent per year faster than one would have thought without taking new varieties into account. The variety gains for Asia are even higher - 2.69 percent per year.Variety gains, structural estimation, trade integration, heterogenous firms.

Estudio de factibilidad técnica y económica para la generación eólica y solar fotovoltaica en la zona de Hobo-Huila

En el presente proyecto se realizó un estudio de factibilidad técnica y económica para la implementación de energía solar y energía eólica en una piscicultura situada en el municipio de Hobo-Huila, donde primero se hizo una revisión de la documentación básica necesaria del funcionamiento de estas dos tecnologías, esta revisión se realizó con un enfoque matemático para poder determinar la energía que puede producir una turbina eólica y un grupo de paneles solares en la zona. Para la investigación, primero se recolectaron los datos de viento y de irradiación solar por medio de equipos de medida y páginas web, luego se procesaron los datos por medio de herramientas matemáticas como Matlab, para así determinar el potencial energético de la zona. Posteriormente se realizó una evaluación económica del sistema para determinar la factibilidad económica del proyecto

Relationships, Layoffs, and Organizational Resilience: Airline Industry Responses to September 11

The terrorist attacks of September 11th, 2001 affected the U.S. airline industry more than almost any other industry. Certain of these companies emerged successful, however, and demonstrated remarkable resilience while others languished. This investigation identifies the reasons why some airline companies recovered successfully after the attacks while others struggled. Evidence is provided that layoffs after the crisis, while intended to foster recovery, instead inhibited recovery throughout the four years after the crisis. But layoffs after the crisis were strongly correlated with the lack of financial reserves and the lack of a viable business model prior to the crisis. Digging deeper, we find that having a viable business model itself depended on the extent to which positive employee relationships had been achieved and maintained over the long term. One implication of our findings is that layoffs, while reducing costs in the short term, may also undermine the positive relationships that are critical for achieving lasting recovery.Relationships, layoffs, organizational resilience, terrorist attacks, aviation.

TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.

Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed

Estudio dinámico de un sistema de pila de hidrógeno

En este trabajo final de carrera se realizará un modelo matemático de forma computacional sobre el comportamiento de las celdas de combustión de hidrógeno, implementando el modelo de Pukrushpan en Modelica. Estará dividida por dos partes: La primera de ellas será la realización del modelo matemático basado en la tesis de Pukrushpan, donde se definirán las ecuaciones necesarias para poder predecir el comportamiento de la celda. Una vez realizada esta fase se comprobarán los resultados obtenidos, para así poder llegar a la conclusión de que el comportamiento de la celda es el esperado. Una vez corroborada se procederá a la siguiente parte. La segunda parte consistirá en la realización de una pila de hidrógeno con refrigeración y con interacción con el medio ambiente para así poder ver el comportamiento de la temperatura interior de la pila y de la potencia que suministra está a unas condiciones de trabajo específicas. Realizando dos tipos de refrigeración, una en la cual la refrigeración será con un flujo constante y una temperatura constante en un circuito abierto, mientras que la otra será la realización de un circuito cerrado con un depósito con un flujo constante pero con una temperatura que ira variando dependiendo de las condiciones de trabajo simulando así un comportamiento más realista. También se representara y observara el comportamiento que tiene la potencia térmica que se va con el flujo, esto se conoce más como pérdidas térmicas producidas por la refrigeración, una vez visto esta parte podremos saber la potencia real y podremos ver el rendimiento que nos proporciona estos dos sistemas.En aquest treball final de carrera es realitzarà un model matemàtic de forma computacional sobre el comportament de les cel·les de combustió d’hidrogen, implementant el model del Pukrushpan al Modelica. Es dividirà amb dues parts: La primera de elles serà la realització d’un model matemàtica basat en la tesis de Pukrushpan, on es definiran les equacions necessàries per poder predir el comportament de la cel·la. Una vegada realitzada aquesta fase es comprovaran els resultats obtinguts, per així poder arribar a la conclusió de que el comportament de la cel·la es el esperat. Una vegada es corroborat es procedirà a la següent part. La segona part consistirà en la realització d’una pila d’hidrogen amb refrigeració y amb interacció amb el medi ambient per així poder veure el comportament de la temperatura interior de la pila y el de la potencia que subministra aquesta amb unes condicions de treball especifiques. Realitzant dos tipus de refrigeració, una en la que la refrigeració es amb un flux y temperatura constant en un circuit obert, mentre que l’altre es realitzarà amb un circuit tancat amb un dipòsit amb un flux constant però amb una temperatura que anirà canviant dependent de les condicions de treball, simulant així un comportament mes realista. També es podrà representar y observar el comportament que te la potencia tèrmica que sen va amb el flux, això es coneix mes com pèrdues tèrmiques produïdes per la refrigeració, una vegada vist aquesta part podrem saber la potencia real y podrem veure el rendiment que ens proporciona aquells dos sistemes.In this thesis a mathematical model will be realized in a computational form about the hydrogen combustion cells behaviour, implementing the Pukrushpan model in Modelica. It will be divided in two parts: The first of them will show the realization of the mathematical model, which is based on Pukrushpan thesis, where the necessary equations will be defined to predict the cells behaviour. Once it is done, the results will be checked so it can be concluded that the cell's behaviour was the expected. After the results have been confirmed, it will continue with the second part. The second part will consist of a hydrogen battery with refrigeration and ambiental interaction in such a way to be able to see internal temperature behaviour of the cell and the potency which it can provide to any specific conditions of work. Performing two types of cooling, one in which cooling will be done with a constant flow and temperature in an open circuit, while the other will be the implementation of closed circuit with a reservoir having a constant flow but with a temperature that will vary depending on the working conditions, thus simulating a more realistic behaviour. The behaviour of the thermal power that goes with the flow will also be represented and observed, this is better known as thermal losses produced by refrigeration, once this part has been seen we will be able to known the real power and we will be able to see the performance provided by these two systems

Large commercial airports in the United States : operative revenue framework

Thesis (S.M.)--Massachusetts Institute of Technology, Dept. of Urban Studies and Planning, 2002.Includes bibliographical references (leaves 227-230).The air transportation system in the United States is in a state of constant change and adaptation. Greatly affected by rapid changes in the industry are the large commercial airports that handle the greater proportion of passenger traffic. To increase capacity, maintain adequate levels of safety and security, and provide increased convenience and comfort to passengers, these airports need to invest heavily in capital programs, whose prices continue to escalate rapidly. The funding of capital programs for airports in the United States is closely associated with their operating revenue structures. Therefore, this thesis develops a framework for understanding these operating revenue structures. The high concentration of the air traffic in the United States suggests that a large portion of investment in airport infrastructure will be destined to few large facilities. Hence the primary area of concern of this study is the largest commercial airports in the United States Part I examines the financial data of the airports at the aggregate level to create a consolidated financial profile of these facilities. The consolidated operating revenue is analyzed to identify the most important line items. Special consideration is given to the alternative cost recovery methodologies - residual, compensatory and hybrid - used by airport operators to set their aeronautical fees. The objective of this exercise is to identify the main drivers and factors that shape the revenue structure of large commercial airports. In addition, by synthesizing scattered operational and financial data, the research highlights the impact of airport operations and business practices on the airports' revenues. Part Il contains the case studies of three airports. Each case is evaluated within the basic framework used to analyze the system at an aggregate level in Part 1. However, the evaluation of the case studies also emphasizes the unique characteristics of each case. The case studies include Logan International Airport in Boston (BOS), Dallas/Fort Worth International Airport (DFW), and Baltimore/Washington International Airport (BWI).by Victor Rivas.S.M

Economic Contribution and Productivity of ATM

This paper estimates the economic contributions of ATM to GDP and to employment in selected countries, as well as to provide some measures of ATM-related investment and economic productivity. Its focus, driven in part by availability of data, is on the European and North American economies. Incomplete information and estimates along parallel lines are also provided for small groups of States in Central and South America, South Asia and South Africa. The total impact of ATM (including direct, indirect and induced effects) on North American and European GDP in 2002 was estimated to be of the order of $22 billion, with total direct, indirect and induced employment at approximately 230,000 jobs. In these two regions, ATM capital investment amounted to approximately 20$2.6 billion) of revenue in 2002. Considering only direct values, worldwide ATM revenues were estimated to be in the range of $16-20 billion in 2002. Numerous other estimates of a similar nature are provided. Comparisons with other European data, confirm the view of ATM as a sector in which jobs have high skill content. Productivity appears to be comparable to that in other technologically advanced sectors of the economy. The findings of this study should be treated as preliminary, in view of data limitations and the diverse economic characteristics of the countries and regions examined.Air traffic management, productivity, aviation

Automatización de cámaras de frío para leche

El presente informe consistió en el diseño de la automatización de dos cámaras de frío en la Empresa “Indulac” dedicada a la pasteurización de leche. Para la automatización de estas cámaras se implementó un sistema de control de temperatura a través de un PLC (Controlador Lógico Programable), difusores que permiten el enfriamiento de la leche en las condiciones indicadas y mediante parámetros de temperatura que permiten que la leche no llegue a un punto de congelación y realice un “defrost”. Para esto en el diseño se acopló diferentes dispositivos electrónicos que pudieran llevar a cabo las funciones necesarias para cumplir con los parámetros de temperatura. Para obtener los parámetros de temperatura se realizaron pruebas con las cámaras llenas de productos y sin producto debido a la infraestructura de las cámaras que no tenían una forma rectangular. Para solucionar el problema del enfriamiento adecuado se planteó implementar un tablero donde el operador pudiera seleccionar tanto manual como automático el sistema de enfriamiento, para ello se propuso cambiar la conexión de los difusores y realizar el sistema de control electrónico.This report was to design automation two cold rooms in Business "Indulac" dedicated to the pasteurization of milk. For the automation of these cameras system temperature control is implemented through a PLC (Programmable Logic Controller), diffusers that allow cooling of milk in the prescribed conditions and temperature parameters by allowing the milk does not reach a freezing point and make a "defrost". For this design different electronic devices that could carry out the necessary measures to comply with the parameters temperature was coupled functions. For the parameters of temperature test chambers filled with products without product due to the infrastructure of the cameras did not have a rectangular shape were made. To solve the problem of adequate cooling was raised implement a board where the operator could select either manual or automatic cooling system, it was proposed to change the connection of the diffusers and perform electronic control system