Opsin expression predicts male nuptial color in threespine stickleback.

Theoretical models of sexual selection suggest that male courtship signals can evolve through the build-up of genetic correlations between the male signal and female preference. When preference is mediated via increased sensitivity of the signal characteristics, correlations between male signal and perception/sensitivity are expected. When signal expression is limited to males, we would expect to find signal-sensitivity correlations in males. Here, we document such a correlation within a breeding population of threespine stickleback mediated by differences in opsin expression. Males with redder nuptial coloration express more long-wavelength-sensitive (LWS) opsin, making them more sensitive to orange and red. This correlation is not an artifact of shared tuning to the optical microhabitat. Such correlations are an essential feature of many models of sexual selection, and our results highlight the potential importance of opsin expression variation as a substrate for signal-preference evolution. Finally, these results suggest a potential sensory mechanism that could drive negative frequency-dependent selection via male-male competition and thus maintain variation in male nuptial color

Efficient cloning system for construction of gene silencing vectors in Aspergillus niger

An approach based on Gateway recombination technology to efficiently construct silencing vectors was developed for use in the biotechnologically important fungus Aspergillus niger. The transcription activator of xylanolytic and cellulolytic genes XlnR of A. niger was chosen as target for gene silencing. Silencing was based on the expression vector pXLNRir that was constructed and used in co-transformation. From all the strains isolated (N = 77), nine showed poor xylan-degrading activities in two semi-quantitative plate assays testing different activities for xylan degradation. Upon induction on D-xylose, transcript levels of xlnR were decreased in the xlnR-silenced strains, compared to a wild-type background. Under these conditions, the transcript levels of xyrA and xynB (two genes regulated by XlnR) were also decreased for these xlnR-silenced strains. These results indicate that the newly developed system for rapid generation of silencing vectors is an effective tool for A. niger, and this can be used to generate strains with a tailored spectrum of enzyme activities or product formation by silencing specific genes encoding, e.g., regulators such as Xln

Transcriptional profiling of Aspergillus niger

The industrially important fungus Aspergillus niger feeds naturally on decomposing plant material, of which a significant proportion is lipid. Examination of the A. niger genome sequence suggested that all proteins required for metabolic conversion of lipids are present, including 63 predicted lipases. In contrast to polysaccharide-degrading enzyme networks, not much is known about the signaling and regulatory processes that control lipase expression and activity in fungi. This project was aimed to gain better understanding of lipid degradation mechanisms and how this process is regulated in A. niger, primarily via assessment of its gene transcription levels. Minimizing biological and technical variation is crucial for experiments in which transcription levels are determined, such as microarray and quantitative real-time PCR experiments. However, A. niger is difficult to cultivate in a reproducible way due to its filamentous growth. In addition, the complex processing steps of transcriptomics technologies add non-experimental variation to the biological variation. To reduce this data noise, robust protocols based on a batch-fermentation setup were developed. Variation in this setup was surveyed by examining the fungal transcriptional response towards a pulse of D-xylose. The sources of non-experimental variation were described by variance components analysis. Two-thirds of total variation stems from differences in routine handling of fermentations, but in absolute terms this variation is low. As D-xylose is an inducer of the xylanolytic system, the high reproducibility of cultures for the first time allowed a detailed description of the global fungal transcriptional response towards D-xylose using microarrays. The transcriptional response towards three plant derived oils was examined in another study. Both olive oil and a wheat-gluten extracted oil induce the transcription of genes involved in lipid metabolism and peroxisome assembly, albeit with different expression profiles. The third oil, a plant membrane lipid, did not trigger a transcriptional response. Microarray data are related to the physiology of the fungus. To better understand the general principles that underlie gene regulation and gene transcription, microarray data from cultures grown under mildly and strongly perturbed conditions were analyzed for co-expression of genes. Despite the diverse culturing conditions, co-expressed gene modules could be identified. Some of these modules can be related to biological functions. For some modules, conserved promoter elements were identified, which suggests that genes in these modules are regulated on a transcriptional level. The work described in this thesis shows that (i) high-quality -omics data for A. niger can be generated; that (ii) analysis and interpretation of these data enhances our understanding of the xylanolytic and lipid metabolic regulons; and (iii) that these data give insight into the regulatory mechanisms of this fungus. <br/

Continuous-flow IRMS technique for determining the 17O excess of CO2 using complete oxygen isotope exchange with cerium oxide

This paper presents an analytical system for analysis of all single substituted isotopologues (¹²C¹⁶O¹⁷O, ¹²C¹⁶O¹⁸O, ¹³C¹⁶O¹⁶O) in nanomolar quantities of CO₂ extracted from stratospheric air samples. CO₂ is separated from bulk air by gas chromatography and CO₂ isotope ratio measurements (ion masses 45 / 44 and 46 / 44) are performed using isotope ratio mass spectrometry (IRMS). The ¹⁷O excess (Δ¹⁷O) is derived from isotope measurements on two different CO₂ aliquots: unmodified CO₂ and CO₂ after complete oxygen isotope exchange with cerium oxide (CeO₂) at 700 °C. Thus, a single measurement of Δ¹⁷O requires two injections of 1 mL of air with a CO₂ mole fraction of 390 μmol mol⁻¹ at 293 K and 1 bar pressure (corresponding to 16 nmol CO₂ each). The required sample size (including flushing) is 2.7 mL of air. A single analysis (one pair of injections) takes 15 minutes. The analytical system is fully automated for unattended measurements over several days. The standard deviation of the ¹⁷O excess analysis is 1.7&permil;. Multiple measurements on an air sample reduce the measurement uncertainty, as expected for the statistical standard error. Thus, the uncertainty for a group of 10 measurements is 0.58&permil; for &Delta; ¹⁷O in 2.5 h of analysis. 100 repeat analyses of one air sample decrease the standard error to 0.20&permil;. The instrument performance was demonstrated by measuring CO₂ on stratospheric air samples obtained during the EU project RECONCILE with the high-altitude aircraft Geophysica. The precision for RECONCILE data is 0.03&permil; (1&sigma;) for δ¹³C, 0.07&permil; (1&sigma;) for δ¹⁸O and 0.55&permil; (1&sigma;) for &delta;¹⁷O for a sample of 10 measurements. This is sufficient to examine stratospheric enrichments, which at altitude 33 km go up to 12&permil; for &delta;¹⁷O and up to 8&permil; for δ¹⁸O with respect to tropospheric CO₂ : &delta;¹⁷O ~ 21&permil; Vienna Standard Mean Ocean Water (VSMOW), δ¹⁸O ~ 41&permil; VSMOW (Lämmerzahl et al., 2002). The samples measured with our analytical technique agree with available data for stratospheric CO₂

Revealing charge-tunneling processes between a quantum dot and a superconducting island through gate sensing

We report direct detection of charge-tunneling between a quantum dot and a superconducting island through radio-frequency gate sensing. We are able to resolve spin-dependent quasiparticle tunneling as well as two-particle tunneling involving Cooper pairs. The quantum dot can act as an RF-only sensor to characterize the superconductor addition spectrum, enabling us to access subgap states without transport. Our results provide guidance for future dispersive parity measurements of Majorana modes, which can be realized by detecting the parity-dependent tunneling between dots and islands.Comment: 6 pages, 4 figures, supplemental material included as ancillary fil

Mass-luminosity relation and pulsational properties of Wolf-Rayet stars

Evolution of Population I stars with initial masses from 70M_\odot to 130M_\odot is considered under various assumptions on the mass loss rate \dot M. The mass-luminosity relation of W-R stars is shown to be most sensitive to the mass loss rate during the helium burning phase \dot M_{3\alpha}. Together with the mass-luminosity relation obtained for all evolutionary sequences several more exact relations are determined for the constant ratio f_{3\alpha}=\dot M/\dot M_{3\alpha} with 0.5 \le f_{3\alpha} \le 3. Evolutionary models of W-R stars were used as initial conditions in hydrodynamic computations of radial nonlinear stellar oscillations. The oscillation amplitude is larger in W-R stars with smaller initial mass or with lower mass loss rate due to higher surface abundances of carbon and oxygen. In the evolving W-R star the oscillation amplitude decreases with decreasing stellar mass M and for M < 10M_\odot the sufficiently small nonlinear effects allow us to calculate the integral of the mechanical work W done over the pulsation cycle in each mass zone of the hydrodynamical model. The only positive maximum on the radial dependence of W is in the layers with temperature of T\sim 2e5K where oscillations are excited by the iron Z--bump kappa-mechanism. Radial oscillations of W-R stars with mass of M > 10M_\odot are shown to be also excited by the kappa-mechanism but the instability driving zone is at the bottom of the envelope and pulsation motions exist in the form of nonlinear running waves propagating outward from the inner layers of the envelope.Comment: 15 pages, 10 figures, submitted to Astronomy Letter

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos

A new limit on the Ultra-High-Energy Cosmic-Ray flux with the Westerbork Synthesis Radio Telescope

A particle cascade (shower) in a dielectric, for example as initiated by an ultra-high energy cosmic ray, will have an excess of electrons which will emit coherent \v{C}erenkov radiation, known as the Askaryan effect. In this work we study the case in which such a particle shower occurs in a medium just below its surface. We show, for the first time, that the radiation transmitted through the surface is independent of the depth of the shower below the surface when observed from far away, apart from trivial absorption effects. As a direct application we use the recent results of the NuMoon project, where a limit on the neutrino flux for energies above $10^{22}$\,eV was set using the Westerbork Synthesis Radio Telescope by measuring pulsed radio emission from the Moon, to set a limit on the flux of ultra-high-energy cosmic rays.Comment: Accepted for publication in Phys. Rev.