Cloning and DNA sequence of the 5'-exonuclease gene of bacteriophage T5

AbstractThe nucleotide sequence of the BalI-PstI fragment of T5 DNA, 1347 bp in length, coding for 5'-exonuclease (D15 gene), has been determined. A coding region of the gene contains 873 bp and is preceded by a typical Shine-Dalgarno sequence. The D15 gene belongs to a cluster, consisting of at least 3 genes, in which a termination codon of a preceding gene overlaps an initiation codon of the following one. The sequence contains an open reading frame for 291 amino acid residues. The molecular mass of the 5'-exonuclease calculated from the predicted amino acid sequence is 33400 Da

The nucleotide sequence of bacteriophage T 5 leucine tRNA

AbstractUniformly 32P-labeled bacteriophage T5 leucine tRNA has been isolated by two-dimensional gel electrophoresis from phage-infected E. coli cells. Its nucleotide sequence has been determined by conventional techniques using TLC on cellulose for oligonucleotide fractionation:pGGGGCUAUGCUGGAACDGmGDAGACAAUACGGCCUUAGm;6UΨCCGUAGCUUAAA UGCGUGGGAGT'ΨCGAGUCUCCCUAGCCCCACCAoh.This tRNA has anticodon sequence UAG, which can presumably recognize all the four leucine-specific codons (CUN). The main feature of T5 tRNALeu is the absence of the A10-C25 and C31-Ψ39 pairing in the D and anticodon stems, respectively

Проблема ориентации субъектов социальной деятельности в изменяющемся мире.

Ориентация рассматривается в качестве значимого феномена, влияющего на деятельность субъекта в соременном изменяющемся мире. Теоретическая неисследованность и практическая востребованность ориентации образуют предпосылки постановки соответствующей проблемы в социальном познаниии определении направлений и средств ее решения

Универсалистская интенция философии и проблема человека в обществе знания.

Статья посвящена рассмотрению роли философии на этапе перехода общества к новой форме его организации – обществу знания. Устанавливается, что, будучи особой реальностью, знание порождает не только новые возможности общественного развития, но и новые проблемы, в решении которых повышается значимость философии как инструмента нахождения человеком своей определенности, сущности, смысла и цели жизни в мире противоречий, коренящихся как в самом человеке, так и в его отношениях с природой и обществом. = The article is devoted to the role of philosophy in the transition period of the society to a new form of organization – knowledge society. It was found out that being a special reality knowledge generation not only new opportunities of social development, but also new problem, solving of which increases philoso-phy importance as instrument of identification by the man his definiteness, nature, meaning and goal in life in the world of contradiction, the roots of which are both in the man himself and in his relations with nature and society

Physical research of microgravity influence on physical phenomenon in cryogenic liquids and general-purpose onboard cryogenic facility for realization of this researchaboard International Space Station

The united research plan named "Boiling" is created on the basis of several cryogenic research projects developed by experts in Russia and Ukraine for International Space Station. The "Boiling" plan includes 8 first experiments aimed at investigating the influence of microgravity on boiling processes, heat transfer and hydrodynamics in liquid helium being either under normal or superfluid conditions. The experiments are supposed to be carried out with individual cells collected inside a single cryogenic onboard experimental facility. The international research program experiments are characterized by the following features: utilization of several artificially simulated microgravity levels, owing to rotation of the experimental helium cryostat; visualization of the processes that occur in liquid helium; research of boiling and hydrodynamics both in a large volume of stationary liquid, and in a liquid flow running through a channel. Upon completion of the "Boiling" research plan, the cryogenic onboard facility created for International Space Station would be able to find its application in further scientific and experimental researches with helium

Ориентационный подход в науке и образовании

В рамках поиска ответов на вызовы времени в статье анализируется идея ориентационного подхода и ме­ханизмы его реализации в научной и образовательной сферах

Ориентационные аттракторы в современном научном познании.

В статье вопросы инновационного развития общества рассматриваются в свете взаимодействия науки, философии и образования. Изучается специфика становления и внедрения новых философ­ских категорий в общественную практику в качестве инструментов априорной ориентации произ­водителей и потребителей научного знания.