Medication non-adherence in the homeless population in an Intermountain West city

Background: Homelessness happens when people or household are unable to acquire and/or maintain housing they can afford. Approximately 17% of homeless individuals are also chronically ill. Studies have often not objectively measured medication non- adherence among the homeless population, probably due to lack of consistent pharmacy records. This study proposed to objectively estimate medication non-adherence to chronic medications among the homeless population in Salt Lake City, Utah. Methods: A retrospective study design was used based on the pharmacy records from the Fourth Street Pharmacy based on four classes of chronic medications - asthma, diabetes, statins, and psychiatric medications. Data was collected between November 1, 2010 and February 28, 2011 on the variables: date of original prescription, number of refills on the original prescription, date of 1st, 2nd, 3rd, and 4th fills, age, gender, and race. Primary non-adherence and medication refill non-adherence based on Continuous Measure of Medication Gaps were calculated. Results: The medication refill non-adherence rate was 38.8% with asthma medications, 38.5% with diabetic medications, 27.2% with statins, and 47.1% with psychiatric medications. The primary non-adherence rate varied from zero percent to 20%. Conclusion: The study concluded that this population has comparable non-adherence rates with asthma, diabetes, cholesterol lowering, and certain psychiatric medications than the general population.   Type: Original Researc

Genetic dissection of MHC-associated susceptibility to Lepeophtheirus salmonis in Atlantic salmon

Background: Genetic variation has been shown to play a significant role in determining susceptibility to the salmon louse, Lepeophtheirus salmonis. However, the mechanisms involved in differential response to infection remain poorly understood. Recent findings in Atlantic salmon (Salmo salar) have provided evidence for a potential link between marker variation at the major histocompatibility complex (MHC) and differences in lice abundance among infected siblings, suggesting that MHC genes can modulate susceptibility to the parasite. In this study, we used quantitative trait locus (QTL) analysis to test the effect of genomic regions linked to MHC class I and II on linkage groups (LG) 15 and 6, respectively. Results: Significant QTL effects were detected on both LG 6 and LG 15 in sire-based analysis but the QTL regions remained unresolved due to a lack of recombination between markers. In dam-based analysis, a significant QTL was identified on LG 6, which accounted for 12.9% of within-family variance in lice abundance. However, the QTL was located at the opposite end of DAA, with no significant overlap with the MHC class II region. Interestingly, QTL modelling also revealed evidence of sex-linked differences in lice abundance, indicating that males and females may have different susceptibility to infection. Conclusion: Overall, QTL analysis provided relatively weak support for a proximal effect of classical MHC regions on lice abundance, which can partly be explained by linkage to other genes controlling susceptibility to L. salmonis on the same chromosom

Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations

Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten β- and 2 previously reported α-globin defects were identified. The Fil-ipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the –α 3.7 /αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. Conclusion: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations

AgBioData consortium recommendations for sustainable genomics and genetics databases for agriculture

The future of agricultural research depends on data. The sheer volume of agricultural biological data being produced today makes excellent data management essential. Governmental agencies, publishers and science funders require data management plans for publicly funded research. Furthermore, the value of data increases exponentially when they are properly stored, described, integrated and shared, so that they can be easily utilized in future analyses. AgBioData (https://www.agbiodata.org) is a consortium of people working at agricultural biological databases, data archives and knowledgbases who strive to identify common issues in database development, curation and management, with the goal of creating database products that are more Findable, Accessible, Interoperable and Reusable. We strive to promote authentic, detailed, accurate and explicit communication between all parties involved in scientific data. As a step toward this goal, we present the current state of biocuration, ontologies, metadata and persistence, database platforms, programmatic (machine) access to data, communication and sustainability with regard to data curation. Each section describes challenges and opportunities for these topics, along with recommendations and best practices

AgBioData consortium recommendations for sustainable genomics and genetics databases for agriculture

The future of agricultural research depends on data. The sheer volume of agricultural biological data being produced today makes excellent data management essential. Governmental agencies, publishers and science funders require datamanagement plans for publicly funded research. Furthermore, the value of data increases exponentially when they are properly stored, described, integrated and shared, so that they can be easily utilized in future analyses. AgBioData (https://www.agbiodata.org) is a consortium of people working at agricultural biological databases, data archives and knowledgbases who strive to identify common issues in database development, curation and management, with the goal of creating database products that are more Findable, Accessible, Interoperable and Reusable. We strive to promote authentic, detailed, accurate and explicit communication between all parties involved in scientific data. As a step toward this goal, we present the current state of biocuration, ontologies, metadata and persistence, database platforms, programmatic (machine) access to data, communication and sustainability with regard to data curation. Each section describes challenges and opportunities for these topics, along with recommendations and best practices

Exploring a New Theoretical Model to Explain the Behavior of Medication Adherence

Medication adherence is essential for optimal therapeutic outcomes. However, non-adherence with long-term therapy is at 50%. Several theoretical models have identified several key factors that could explain medication adherence. Though numerous interventions have been developed based on these theoretical models, the success rates with interventions are not the best. This paper proposes a new Hierarchical Model for Medication Adherence. In this model, we propose medication adherence as a five-tier model with medication adherence as the desirable behavior on the top of the pyramid. From the bottom of the hierarchy upwards, the skills/beliefs/behaviors to be achieved are: health literacy, belief in illness (impacted by perceived susceptibility and severity of illness), belief in medicines (impacted by treatment satisfaction), and self-efficacy (impacted by social support). The model further proposes that each individual will achieve or already have these skills/beliefs/behaviors at various levels. Screening patients for these benchmarks will enable providers to decide where to target interventions