Part production technology

Tato diplomová práce se zabývá technologií výroby plastového dílu pro bateriové moduly. První kapitola obsahuje rozbor základních metod obrábění, kde jsou uvedeny obecné informace o technologiích, která firma, ve které byla tato práce řešena, využívá. Ve druhé kapitole je řešen popis vyráběné součásti a její technologické aspekty pro zhotovení. Další kapitola je věnovaná představení firmy a jejím technologickým možnostem pro výrobu. Zbylá část práce je věnována navržení možných řešení výroby polotovarů a navržení upínání polotovaru. Z vybrané varianty je následně řešena technologie výroby součásti, kde jsou uvedeny technologické řešení jednotlivých operací a výrobní postup. Na závěr je provedeno technicko-ekonomické zhodnocení, kde je řešena vícestrojová obsluha a jsou posouzeny náklady na výrobu navrhovaných variant.This work deals with the production technology of the plastic part for battery modules. First chapter contains analyzis of fundamental methods of machining, where are general informations about technologies which are used in the company with which one is work cooperated. In the second chapter is solved description of manufactured part and its technological aspects for the production. Next chapter is dedicated for introducing the company and its technological possibilities for the manufacturing. The rest part of the work is dedicated for designing production of the semi-finished product and clamping of the semi-finished product. With the selected variant is solved production technology of the part, where are indicated technological solutions of each operations and production process. In the end is realized technological-economic valorization, where is solved service of more machines and judged cost for production of designed variants.

St Vitus' Cathedral in Prague: Liturgy, Symbolism and Architectural Imitation in Medieval Bohemia

St Vitus' Cathedral in Prague: Liturgy, Symbolism and Architectural Imitation in Medieval Bohemia In this thesis, the focus is put on the Wenceslas Chapel in St Vitus' Cathedral, the unusual design of which seems to have two levels of meanings: On the one hand, it was probably designed as a recreation of an earlier rotunda that had been founded by St Wenceslas. On the other hand, it seems that the intention was made the chapel and the whole cathedral would resemble the Church of the Holy Sepulchre in Jerusalem, where the Calvary Chapel occupied the same position as the Wenceslas Chapel. This was most likely inspired by presence of the Imperial insignia containing the valuable Passion relics that Charles had acquired in 1350 and placed in the basilica, probably near the Wenceslas Chapel. Perhaps from that reason Charles had the new Gothic chapel decorated with semi-precious stones, because its red spots were associated with the blood of Christ and the Passion. The Wenceslas Chapel together with two Passion chapels at Karlstein Castle, containing Charles IV's private passion treasure, gave rise to the "Passion" architecture of the Luxembourg period. It included the church of St Margaret in the Cistercian monastery in Zlatá Koruna and the Resurrection Chapel attached to the church of SS Peter and Paul at...Katedrála sv. Víta v Praze: Liturgie, symbolika a architektonická imitace ve středověkých Čechách V této disertační práci se soustřeďuji na Svatováclavskou kapli ve Svatovítské katedrále, jejíž neobvyklá forma má patrně dvojí význam: na jedné straně byla zřejmě navržena jako "znovuzrození" starší rotundy založené sv. Václavem a na straně druhé mohlo být záměrem kapli a celou katedrálu připodobnit k chrámu Božího hrobu v Jeruzalémě, kde kaple Kalvárie má stejné umístění jako Svatováclavská kaple. Důvodem proto mohlo být umístění císařských insignií, obsahujících cenné pašijové relikvie, které Karel získal v roce 1350, do blízkosti této kaple. Ze stejného důvodu zřejmě nechal císař kapli dekorovat polodrahokamovým obkladem, protože obsahovaly rudé skvrny, spojované s Kristovou krví a Pašijemi. Svatováclavská kaple společně se dvěma kaplemi zasvěcenými pašijím na hradě Karlštejně tak dala za vznik "pašijové" architektuře lucemburské doby. K ní je možné řadit také kostel sv. Markéty v cisterciáckém klášteře v Zlaté Koruně a kapli Vzkříšení při kostele sv. Petra a Pavla na Vyšehradě, postavenou Václavem Králíkem z Buřenic zřejmě jako imitaci Rotundy chrámu Božího hrobu v Jeruzalémě. Samotný kostel sv. Petra a Pavla byl přitom patrně zamýšlen jako architektonická imitace baziliky sv. Petra v Římě, kde byl Karel...Ústav dějin křesťanského uměníInstitute of Christian Art HistoryCatholic Theological FacultyKatolická teologická fakult

Comparative Analysis of New Developments Around the City of Brno

Diplomová práce se věnuje analýze podkladů pro realizaci nové zástavby v širším okolí města Brna. Práce je rozdělena na část teoretickou a část empirickou. Teoretická část se zabývá vymezením a charakterizací jednotlivých etap realizace stavebních parcel v podobě technických sítí a komunikací na zemědělských plochách (greenfields), určených pro residenční bydlení. V empirické části jsou uvedeny cíle a metodologie výzkumného šetření a je rozdělena na dvě části. První část případové studie se věnuje porovnávání a analyzování nákladů a výnosů developera vybraných lokalit satelitních městeček. V části druhé je upřena pozornost na samotný vývoj ceny pozemků a poukazuje na položky ovlivňující zisk či ztrátu developera. V poslední kapitole se autor práce věnuje tvorbě předběžného výpočtu, pomocí kterého může developer zjistit, zda vybraný projekt satelitního městečka bude úspěšný, nebo nikoli. V závěru diplomová práce poukazuje na důležité faktory, ovlivňující úspěch projektu satelitního městečka.This master’s thesis deals with analysis of documents for the realization of the new buildings the wider area of Brno. It is divided into the theoretical part and the empirical part. The theoretical part describes defines and characterize different stages of implementation of building plots in the framework of utility lines and roads on agricultural land (greenfields), designated for residential housing. In the empirical part goals and methodology of the research project are mentioned and it is divided into two parts. The first part is devoted to case studies comparing and analyzing the costs and revenues of the developer selected localities of satellite towns. The second part is focused on the actual development of land prices. It points to items affecting profit or loss of the developer. In the last chapter the author of this thesis describes creating a preliminary calculation, which the developer can determine whether a satellite town of the selected project will be successful or not. In conclusion, the thesis points out important factors affecting the project success of the satellite town.

Terasa Akropole

Architektonický návrh místa setkávání a centra kulturních událostí soudobých Athén. Návrh založený na požadovaném auditoriu, restauraci a výstavním prostoru se snaží o vytvoření veřejné střešní piazzetty Piazzetta je koncipována jako veřejné prostor přilehlý k hlavní athénské promenádě. Zároveň je piazzeta střechou a hlavním vstupním prostorem do kulturní instituce pod ní. Všichni návštěvníci tak vstupují do budovy skrz městský život na střešní piazzettě.Cílem tohoto uspořádání je představa vzniku fascinující řady neobvyklých situací, které obohatí současný athénský život místním i turistům.Architectural proposal for the cultural events of contemporary Athens. Based on a merging of the mandatory auditorium, the restaurant and the exhibition space, this proposal aims to create an intense rooftop-piazzetta. This piazzeta is conceived as a public platform adjacent to Athen's main promenade. At the same time the piazzeta is covering the cultural institution. All visitors are thus entering the building through the rooftop-piazzetta.Thanks to this configuration, the proposal desires to let emerge a serie of intriguing urban life situations which will enrich both local and tourist experience of contemporary Athens

Business Plan - Barbershop

Táto bakalárska práca sa zaoberá vytvorením podnikateľského plánu na založenie holičstva. Je rozdelená na tri časti, v prvej, teoretickej, sú vysvetlené základné pojmy pre bližšie priblíženie problematiky. Druhá, analytická, analyzuje súčasný stav trhu a posledná sa zameriava priamo na vlastný návrh podnikateľského plánu.The bachelor thesis deals with proposal of business plan for starting up a barber shop. It is divided into three parts. Basic concepts are explained in the first, theoretical part, in order to define the issue closer. The second, analytical part, analyses the current market state and the last one focuses directly on own business plan proposal.

Pattern preferences of DNA nucleotide motifs by polyamines putrescine2+, spermidine3+ and spermine4

The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments