The use of bioactive forages towards organic/sustainable control of gastrointestinal parasites in sheep

The aim of this thesis was to investigate the potential use of bioactive plants as alternative grazing forages to control gastrointestinal parasites of growing lambs. For this purpose four different grazing experiments were conducted using the following bioactive forages: Lotus pedunculatus (lotus), Onobrychis viciifolia (sainfoin), Hedysarum coronarium (sulla), and Cichorium intybus (chicory); the forages were tested against two parasitic ovine nematode species, Teladorsagia circumcincta and Trichostrongy’lus colubriformis. The first two experiments tested the effects of short-term grazing on bioactive forages against the viability and fecundity of adult, and the establishment and development of larval nematodes of T. colubriformis (Chapter Two) and T. circumcincta (Chapter Three) species. In the first experiment, grazing on bioactive forages showed no evidence of forage effects upon incoming T. colubriformis larvae or against adult T. colubriformis worms during a two-week period. In contrast, the results form the second experiment showed significant reductions in adult T. circumcincta worm burdens of lambs grazing chicory for a two-week period compared to lambs grazing grass/clover {folium perenne/Trifolium repens). Immature worm burdens were, affected by physiologically and/or immunologically mediated mechanisms, which reduced larval establishment in all treatments. The following experiment (Chapter Four) aimed to investigate the effects of sequential grazing on bioactive forages, firstly on chicory followed by sulla, towards an established adult T. circumcincta worm population of growing lambs. The results showed that grazing on chicory reduced the faecal egg counts (FEC) of infected lambs, whilst the following grazing on sulla provided little evidence of additional benefits. During this grazing period, evidence of emergence of immunity, declining FEC and low wonn establishment rate, were observed across all treatments. The last experiment (Chapter Five) aimed to separate the direct (anthelmintic) and indirect (immunologicaFphysiological) mediated effects of bioactive forages and investigate their effects on acquired immunity against the abomasal nematode T. circumcincta. The results showed elevated immune responses, in terms of nematode larval development and mucosal cell counts, of growing lambs grazing on either sulla or chicory compared to those grazing on grass/clover. It is therefore suggested that the effects of these two bioactive forages are due to a combination of their direct and indirect properties. The potential application of bioactive forages as an alternative to control gastrointestinal parasitic infections in organic/sustainable sheep production systems is considered in the General Discussion (Chapter Six)

Development of a novel PCR based analytical protocol for the characterization of the two variants of prolactin gene that affect milk yield in sheep breeds

Prolactin is a lactogenic hormone which plays a significant role in milk production in mammals, and its depletion in sheep provokes severe reduction of milk secretion. Two different variants within intron 2 of the prolactin gene have been described (A and B) and this polymorphism has been recently proposed as a marker for future breeding schemes in dairy sheep. The present study fully characterized this polymorphism, resulting in a simpler and cost effective PCR-based assay for genetic identification in sheep populations. Up to now, the two variants A and B were identified by their difference in RFLP digestion patterns. This assay, however, is laborious since it requires the generation of a 2.5kb PCR fragment from genomic DNA prior to digestion, which is often difficult to obtain. By sequencing PCR products form AA and BB homozygous animals and performing alignments, we confirmed that the B variant results from a 23bp deletion (sequence: GGTGTTTCTCTTCATAAAGACTC) of the A variant of the prolactin gene. This finding assisted the design of new primers for the identification of prolactin polymorphism based on the size of the PCR product and relinquishes the need of RFLP digestions. Using these developments, we genotyped an experimental flock of 380 Chios breed sheep and carried out association studies. In contrast to other sheep breeds, such as the East Friesian and the Serra da Estela, our preliminary data showed no significant effect of this gene on Chios first lactation milk yield. However, the effects of the prolactin gene merit more investigation

Comparison of Icodextrin and 2.5% Glucose in Potassium Metabolism by Acute K+ load via Dialysate in Continuous Ambulatory Peritoneal Dialysis Patients

This study aimed to compare the increment in plasma potassium concentration ([K+]) as well as the role of internal K+ balance for its changes following acute K+ supplementation between conventional 2.5% glucose (GD) and non-glucose containing dialysate (icodextrin, ID) in continuous ambulatory peritoneal dialysis (CAPD) patients. A total of 9 stable CAPD patients (5 men and 4 women; age, 56±13 years; 7 type-2 diabetics and 2 non-diabetics) on daily 4 exchanges of 2 L of glucose dialysate underwent the 6-hr dwell on fasting in the morning with 2 L of 2.5% glucose mixed with 20 mEq/L of KCl, and then the same regimen was repeated with icodextrin after 1-wk interval. The degree of intraperitoneal absorption was comparable, 65±2% in GD and 68±2% in ID, respectively (p=NS). However, despite the similar plasma K+ levels at the baseline of both regimens, its increment was significantly less in GD than ID, which was accompanied by more marked increase in the calculated intracellular K+ redistribution (68±3% vs. 52±3%, p<0.05). The basal levels of insulin were similar between the GD and ID groups. However, the change, checked up after 2 hours' dwell, from the basal insulin levels was much lower on ID. ID with a lesser degree of transcelluar K+ shift by the decreased secretion of insulin is more effective than the conventional glucose solution for acute K+ repletion via dialysate during CAPD. Furthermore, these results suggested that the role of insulin for the internal K+ balance was intact even in type-2 diabetic patients on CAPD

Variants in the 3'UTR of the ovine Acetyl-Coenzyme A Acyltransferase 2 gene are associated with dairy traits and exhibit differential allelic expression

The acetyl-CoA acyltransferase 2 (ACAA2) gene encodes an enzyme of the thiolase family that is involved in mitochondrial fatty acid elongation and degradation by catalyzing the last step of the respective β-oxidation pathway. The increased energy needs for gluconeogenesis and triglyceride synthesis during lactation are met primarily by increased fatty acid oxidation. Therefore, the ACAA2 enzyme plays an important role in the supply of energy and carbon substrates for lactation and may thus affect milk production traits. This study investigated the association of the ACAA2 gene with important sheep traits and the putative functional involvement of this gene in dairy traits. A single nucleotide substitution, a T to C transition located in the 3′ untranslated region of the ACAA2 gene, was used in mixed model association analysis with milk yield, milk protein yield and percentage, milk fat yield and percentage, and litter size at birth. The single nucleotide polymorphism was significantly associated with total lactation production and milk protein percentage, with respective additive effects of 6.81 ± 2.95 kg and −0.05 ± 0.02%. Additionally, a significant dominance effect of 0.46 ± 0.21 kg was detected for milk fat yield. Homozygous TT and heterozygous CT animals exhibited higher milk yield compared with homozygous CC animals, whereas the latter exhibited increased milk protein percentage. Expression analysis from age-, lactation-, and parity-matched female sheep showed that mRNA expression of the ACAA2 gene from TT animals was 2.8- and 11.8-fold higher in liver and mammary gland, respectively. In addition, by developing an allelic expression imbalance assay, it was estimated that the T allele was expressed at an average of 18% more compared with the C allele in the udder of randomly selected ewes. We demonstrated for the first time that the variants in the 3′ untranslated region of the ovine ACAA2 gene are differentially expressed in homozygous ewes of each allele and exhibit allelic expression imbalance within heterozygotes in a tissue-specific manner, supporting the existence of cis-regulatory DNA variation in the ovine ACAA2 gene. This is the first study reporting differential allelic imbalance expression of a candidate gene associated with milk production traits in dairy sheep

Management of severe hyponatremia: Infusion of hypertonic saline and desmopressin or infusion of vasopressin inhibitors?

Rapid correction of severe hyponatremia carries the risk of osmotic demyelination. Two recently introduced methods of correction of hyponatremia have diametrically opposite effects on aquaresis. Inhibitors of vasopressin V2 receptor (vaptans) lead to the production of dilute urine, whereas infusion of desmopressin causes urinary concentration. Identification of the category of hyponatremia that will benefit from one or the other treatment is critical. In general, vaptans are effective in hyponatremias presenting with concentrated urine and, with the exception of hypovolemic hyponatremia, can be used as their primary treatment. Desmopressin is effective in hyponatremias presenting with dilute urine or developing urinary dilution after saline infusion. In this setting, desmopressin infusion helps prevent overcorrection of the hyponatremia. Monitoring of the changes in serum sodium concentration as a guide to treatment changes is imperative regardless of the initial treatment of severe hyponatremia

Alkali Therapy in Lactic Acidosis

This report attempts to frame the debate about clinical administration of sodium bicarbonate in the setting of lactic acidosis in terms of simple questions. Specifically, we address why we develop lactic acidosis in some circumstances, how acute lactic acidosis impairs cardiovascular function and why sodium bicarbonate may have deleterious effects which limit its utility. We also attempt to explore treatment alternatives to sodium bicarbonate

Principles of Quantitative Fluid and Cation Replacement in Extreme Hyperglycemia

Hyperglycemia may cause profound deficits of water, sodium and potassium through osmotic diuresis, which continues during treatment as long as there is glucosuria. Replacement fluids should cover both the deficits at presentation and the ongoing losses during treatment. At presentation with hyperglycemia, quantitative estimates of the deficits in water, sodium and potassium are based on rapid body weight changes, which indicate changes in body water, and on the serum sodium concentration corrected to a normal serum glucose level. The corrected serum sodium concentration provides a measure of the water deficit relative to the cation deficit (sodium, plus potassium) that is useful in guiding the choice of monovalent cation concentration in the initial replacement fluids. Monitoring clinical status, serum chemistries (glucose, sodium, potassium, total carbon dioxide), urine flow rate, and urine chemistries (sodium and potassium) during the course of fluid and cation replacement therapy is critical. This monitoring guides the volume and composition of replacement solutions for deficits developing during treatment and the management of potassium balance and acid-base abnormalities, including metabolic acidosis, respiratory acidosis, rarely, and others

Principles of Management of Severe Hyponatremia

Hyponatremia represents a serious health hazard.1 Hospitalized patients,2 nursing home residents,3 women,4,5 and children6 exhibit high frequency and/or severity of hyponatremia. Hyponatremia developing during the course of other morbid conditions increases their severity.7–10 Estimates of direct costs for treating hyponatremia in the United States ranged between $1.61 and$3.6 billion.11 Clinical manifestations of hyponatremia are universal12,13 and range from subtle (disturbances of balance, problems in cognition detected only during specific testing) to life-threatening manifestations of increased intracranial pressure with life-threatening hypoxia14–16 and noncardiac pulmonary edema.17 Although the treating physicians must make an accurate diagnosis based on well-established and described clinical criteria,1 treatment is also guided by the severity of these manifestations. The magnitude and rate of increase in serum sodium concentration ([Na]) during treatment are critical. Overcorrection of chronic hyponatremia may lead to osmotic myelinolysis,18–21 whereas undercorrection may fail to prevent life-threatening manifestations.1,2

Icodextrin Improves the Serum Potassium Profile with the Enhancement of Nutritional Status in Continuous Ambulatory Peritoneal Dialysis Patients

The impact of glucose-free icodextrin (ID) for overnight dwell as compared to conventional glucose-containing dialysate (GD) on potassium (K+) metabolism in continuous ambulatory peritoneal dialysis (CAPD) patients has not yet been investigated. Serum K+ in a total of 255 stable patients (116 on GD and 139 on ID) on CAPD for more than 6 months and in 139 patients on ID before and after ID use (Pre-ID and Post-ID) were observed along with nutritional markers in a 2-year study period (Jan. 2006 to Dec. 2007). The prevalence of hypokalemia was similar between patients on GD and ID (16.7% vs 17.3%), but was lower on Post-ID than Pre-ID (17.3% vs 20.5%) without statistic significance. The mean serum K+ level was higher on ID than on GD (P<0.05) as well as Post-ID than Pre-ID (P<0.001). In the multivariate analysis, serum K+ levels were positively correlated with serum albumin, and creatinine in all patients (P<0.05), and ID-use in younger patients (age≤56, P<0.001). Serum albumin, creatinine, total CO2, and body mass index were significantly higher on Post-ID than Pre-ID. Icodextrin dialysate for chronic overnight dwell could increase serum K+ levels and lower the prevalence of hypokalemia compared to conventional glucose-containing dialysate. The improved chronic K+ balance in CAPD patients on icodextrin could be related to enhanced nutritional status rather than its impact on acute intracellular K+ redistribution

Fluid balance concepts in medicine: Principles and practice.

The regulation of body fluid balance is a key concern in health and disease and comprises three concepts. The first concept pertains to the relationship between total body water (TBW) and total effective solute and is expressed in terms of the tonicity of the body fluids. Disturbances in tonicity are the main factor responsible for changes in cell volume, which can critically affect brain cell function and survival. Solutes distributed almost exclusively in the extracellular compartment (mainly sodium salts) and in the intracellular compartment (mainly potassium salts) contribute to tonicity, while solutes distributed in TBW have no effect on tonicity. The second body fluid balance concept relates to the regulation and measurement of abnormalities of sodium salt balance and extracellular volume. Estimation of extracellular volume is more complex and error prone than measurement of TBW. A key function of extracellular volume, which is defined as the effective arterial blood volume (EABV), is to ensure adequate perfusion of cells and organs. Other factors, including cardiac output, total and regional capacity of both arteries and veins, Starling forces in the capillaries, and gravity also affect the EABV. Collectively, these factors interact closely with extracellular volume and some of them undergo substantial changes in certain acute and chronic severe illnesses. Their changes result not only in extracellular volume expansion, but in the need for a larger extracellular volume compared with that of healthy individuals. Assessing extracellular volume in severe illness is challenging because the estimates of this volume by commonly used methods are prone to large errors in many illnesses. In addition, the optimal extracellular volume may vary from illness to illness, is only partially based on volume measurements by traditional methods, and has not been determined for each illness. Further research is needed to determine optimal extracellular volume levels in several illnesses. For these reasons, extracellular volume in severe illness merits a separate third concept of body fluid balance