Fibrinolytic Protease-Producing Bacteria with Varied Hemolysis Pattern Associated with Marine Algae Dictyota sp.

The main death factor of cardiovascular disease (CVD) is the formation of a blood clot (thrombus). Thrombus is formed by the action of fibrin, playing a role as a blood coagulation agent. Administration of fibrinolytic enzymes can degrade fibrin through the fibrinolysis process. Therefore, searching for new sources of fibrinolytic enzymes becomes critical in eradicating diseases by fibrinolysis of thrombus. This study aims to isolate fibrinolytic protease-producing bacteria associated with fermented brown algae products Dictyota sp, of Awur Bay, Jepara, Indonesia, and to observe their hemolysis pattern. As many as 14 unique bacterial colonies previously isolated from fermented Dictyota sp. were sub-cultured using Zobell Agar (ZA) medium. Skim Milk Agar (SMA) and Fibrin Agar (FA) were then used as selective media to detect the presence of fibrinolytic protease-producing bacteria, which was indicated by their ability to form a clear proteolytic and fibrinolytic zone simultaneously around bacterial colonies. Hemolysis characteristics of fibrinolytic bacteria were determined using Blood Agar Plate (BAP) to test their ability to produce hemolysin toxin. As a result, of these 14 isolates, 3 of them, namely FD-09, FD-13, and FD-14 (FD= Fermented Dictyota), could produce both proteolytic and fibrinolytic zone with a fibrinolytic index range of 2.0–2.9. Isolate FD-09 is the least pathogenic (g-hemolytic) compared to other fibrinolytic isolates, FD-13 (b-hemolytic) and FD-14 (a-hemolytic), in terms of hemolysin toxicity. In conclusion, fermented Dictyota sp. is a potential source of bacteria-producing fibrin-degrading protease with varied hemolysis patterns. It is necessary to identify bacteria-producing fibrinolytic protease isolates Dictyota sp. and further characterization regarding the specificity and activity of the resulting protease to develop its potential as an antithrombotic agent

UTILIZATION OF TIO₂ IMPREGNATED ZEOLIT-ZSM-5 TO DECREASE CONCENTRATION OF CR (VI) IN SOLUTION AT pH VARIANCE

Chromium (VI) or Cr (VI) is one of heavy metal ions, which presence in the environment comes from industrial waste water disposal such as metallic coating, leather tanning and paint industry. Cr (VI) ions are toxic as they could cause lung cancer, chronic infection and polyps. An effort to decrease Cr (VI) concentration has been done by using TiO₂ impregnated Zeolite ZSM-5 (TiO₂-ZSM-5) at 1,25% w/v concentration with pH variation within 75-minute of UV exposure time. This study aims to investigate the effect of pH variation after addition of TiO₂- ZSM-5 powder on Cr (VI) solution, in a way to reduce the presence of the toxic ions in its solution. Object of this study was Cr (VI) solution at concentration of 50 mg/L. The evaluation was carried out on Cr (VI) solutions as samples including vontrol after adding Zeolite ZSM-5 alone, TiO₂ alone and TiO₂ impregnated Zeolite ZSM5 powder. Data analysis was carried out statistically using One-way Annova.The results showed that initial Cr (VI) concentration was 49,73 mg/L and the percentages of Cr (VI) decrease at pH 2, 4, 6, 8 and 10 respectively were 37,55; 34,72; 25.88; 18,10; 11.11%. It means that the highest percentage of Cr (VI) concentration decrease was at pH 2. Based on the statistical analysis results (p value 0,000), the most significant effects in the decreaseof concentation of Cr (VI) solution used in this study were shown by the addition of TiO₂-ZSM-5 powder and by addition of H+ ion (causing pH=2) into the used solution. As conclusion, treatment using TiO₂ impregnatedZeolite ZSM-5 at pH 2 is potential to be used as a way to handle water pollution caused by Cr (VI)

PROFIL PROTEIN BERBASIS SDS-PAGE PADA ULAT SAGU PENGASAPAN DENGAN DAN TANPA PENGGARAMAN

Sago Larva (Rhynchophorus ferrugineus) is a high source of animal protein typical from Papua. One of weakness sago larva as foodstuff that is easily rot. To avoid decomposition can be done with fumigation and salting preservation. The purpose of this research is looking at the profile of protein fumigation with and without salting in sago larva. The method used is the method of Sodium Dodecyl  Sulfat-Polyacrylamide  Gel Electrophoresis (SDS-PAGE). Research sample used about 13 sago larva. One of sago larva used as a control without salting and fumigation, 6 of sago larva used time fumigation variation 2,4,and 6 minutes, than 6 of sago larva used time fumigation variation with salting at concentration 10% b/b. The results showed sago larva as a control has 31 protein bands different with band after fumigation with and without salting. Larva have been smoked for 2 minutes had 30 protein bands, for 4 minutes had 35 protein bands and for 6 minutes had 32 protein bands. While larva with salting and fumigation for 2 minutes has 29 protein bands, for 4 minutes has 22 protein bands and 6 minutes has 36 protein bands. These results indicate that amount of bands at sago larva are diverse because of different sample. The length time of fumigation then the higher level of the protein denaturation as marked with small value of molecular weight. Keywords: Fumigation, Salting, Sago Larva, SDS-PAG

PROFIL PROTEIN DAGING IKAN BANDENG (Chanos chanos) MENGGUNAKAN SDS-PAGE SEBELUM DAN SESUDAH PENGGARAMAN

Milkfish (Chanos chanos) is potential source of easily digested, yet easily decayed animal protein. Salting using table salt (NaCl) is a common technique used to prevent early spoilage on milkfish meat. In study, the effect of salting on of milkfish was investigated using SDS-PAGE method. The aim were: 1. To evaluate protein profile before and after salting in milkfish at varied salt concentration and salting time. 2. To recommend milkfish salting process based on denaturation level of protein reflected by changes in protein profile compared to that of control. Seven portionsof meat from one fresh milkfish was used as samples (6 portions) and control (1 portion). All samples were salted using NaCl at concentration of 10, 20, and 30% b/b in varied salting time of 30 and 60 mins. The results showed that the milkfish meat before salting process (control) had atotal 15 protein bands. The total protein band number decreased in samples salted for 30 mins at NaCl concentrations of 10, 20 and 30% b/v to become 14, 14 and 12 bands respectively. Further decrease of the band number was observed in samples salted for 60 mins at NaCl concentrations of 10, 20 and 30% b/v where the number became 12, 11 and 10, respectively. Molecular weightanalysis on these results showed that salting process of milkfish for 30 min at NaCl concentration of 10% b/v is most recommended as its profile protein showed the least change of protein bands from control’s.Keywors: Penggaraman, Ikan bandeng profil protein, SDS-PAG

PROFIL PROTEIN BERBASIS SDS-PAGE ULAT SAGU (RHYNCHOPHORUS FERRUGINESUS) HASIL PEMANGGANGAN DENGAN OVEN DAN MICROWAVE

Sago larvae (Rhynchophorus ferruginesus) is a source of animal protein originated from Papua, which has a high protein content. One of the disadvantages of sago larvae as a food ingredient is that it decomposes easily. To avoid decay, preservation could be done by heating with an oven and microwave, but the influence of the heating process to the quality of protein needs to be investigated. The purpose of this study was to analyze the profile of sago larvae protein baked in an oven and microwave with a time variation of sago larvae. The method used was SDS-PAGE (Sodium Dodecyl Sulfate– Polyacrylamide Gel Electrophoresis). The samples used were 13 sago larvae. Alarvae sample was used as a control and was not roasted with an oven and microwave, 6 larvae were baked with an oven with a variation of time 1, 2 and 3 minutes then the other 6 were roasted by microwave with a time variation of 1, 2 and 3 minutes. The results showed that sago larvae as a control had a number of protein bands 26, unlike the protein bands after baking with an oven and microwave. Larvae that have been baked in the oven for 1 minute found 17 protein bands, 20 protein bands were found for 2 minutes, and for 3 minutes were found 10 protein bands. Whereas in the sago larvae sample which was baked in the microwave for 1 minute found 16 protein bands, for 2 minutes found 11 protein bands and for 3 minutes found 12 protein bands. These results indicatedthe longer the heating time, the higher the level of protein denaturation.This marked by more protein bands on protein profile with smaller molecular weight values.Keywords: roasting, sago larvae, SDS-PAG

Improvement of Awareness of Diabetes Mellitus Disease Risks and Self-Monitoring Motivation Through Blood Sugar Screening and Counseling for Dian Darat Village Community, Southeast Maluku

Diabetes Mellitus (DM) disease is among the top 10 causes of death in the world. It is a metabolic disease causing unusual high blood sugar level in the body. Fortunately, controlling risk factors through early detection can prevent the abnormality. Dian Darat is among villages in Southeast Maluku Regency, where DM screening is rarely carried due to its relatively remote location. This community activity aimed to provide DM disease education through blood sugar screening and counselling for village’s community. Methods included early detection of DM and counselling based on blood sugar level screening results supported by poster media. Screening test results showed that 9 out of 26 respondents (35%) had blood sugar level higher than normal. Based on results of pre- and post-test scores before and after the education, there was an increase in participants’ knowledge regarding DM disease by 62 %. (from average score of 56,15 ± 13,88 to 90,77 ± 9,77, n=26, p ≤ 0.01). Future community services are recommended on similar and more sustainable community service activities by cooperation with other relevant stakeholders to optimize results

AKTIVITAS ANTI-BIOFILM BAKTERI DARI PRODUK ALGA COKLAT Dictyota sp.

Infeksi bakteri dapat memperlambat penyembuhan, menyebabkan deformitas dan kematian sel. Hal ini disebabkan bakteri menghasilkan biofilm yang memberikan sifat resistensi terhadap antibiotik yang diberikan pada luka yang terinfeksi bakteri itu. Infeksi yang terkait dengan biofilm merupakan mayoritas dari semua infeksi bakteri yang kronis atau berulang dalam tubuh manusia. Alginat liase.merupakan enzim yang mampu mendegradasi alginat, yang merupakan komponen utama biofilm bakteri. Oleh karena itu, pencarian sumber baru alginat liase menjadi penting dalam pemberantasan penyakit infeksi terutama yang terkait dengan pembentukan biofilm. Penelitian ini bertujuan untuk mengetahui kemampuan simbion dari produk fermentasi alga coklat Dictyota sp. yang diperoleh dari Teluk Awur, Jepara, Indonesia dalam mendegradasi biofilm bakteri. Sampel makroalga segar difermentasi terlebih dahulu selama 7 hari untuk merangsang aktivitas degradasi oleh bakteri simbion secara umum. Data yang diperoleh dari hasil kultur dan resistensi dapat dijadikan sebagai dasar dilakukan terapi empiris. Bakteri simbion Dictyota sp ditumbuhkan pada media Zobell Agar (ZA) dan kemudian masing-masing koloni spesifik yang tumbuh dimurnikan menggunakan media Nutrient Agar (NA). Agar minimal alginat kemudian digunakan sebagai media selektif untuk mendeteksi keberadaan bakteri alginolitik yang ditunjukkan dengan kemampuannya membentuk zona alginolitik yang jernih disekitar koloni bakteri. Dari 14 isolat bakteri simbion Dictyota sp, 3 yaitu FD-01, FD-03, dan FD-04, dapat menghasilkan zona alginoliti dengan nilai indek alginolitik berkisar antara 0,5 – 1,0. Kesimpulannya, Dictyota sp. merupakan sumber potensial bakteri penghasil enzim antibiofilm, alginat lias

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon)

Resveratrol is a potent anti cancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS) encodinggene from melinjo plant (Gnetumgnemon L.) has been carried out as pan of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5\u27 GTTCCACCTGCGAAGCAGCC37 and GGR2 (5\u27 CTGGATCGCACATCC TGGTG 37 primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gen

GENOTYPIC AND PHENOTYPIC CHARACTERIZATION OF Alcaligenes javaensis JG3 POTENTIAL AS AN EFFECTIVE BIODEGRADER

Utilization of glycerol by lipase producing bacteria offers great benefits for fat and oil waste degradation and waterwaste treatment. Nevertheless, there have been lack of reports about the availability of non-pathogenic, lipase producing bacteria, which could naturally degrade glycerol produced from the lipolysis process by lipase. This study reported a newly identified species of rhizobacteria, Alcaligenes javaensis JG3, which is not only able to produce high level of lipase, but also able to degrade glycerol molecules. Identification of strain JG3 was carried out using SEM (Scanning Electron Microscope), BD Phoenix 100 Automated Microbiology System and 16S rRNA gene analysis to determine its taxonomy status. The ability of the strain to metabolize glycerol was investigated both genotypically and phenotypically using degenerate PCR and a glycerol minimal medium. Identification test results showed that strain JG3 belongs to genus Alcaligenes, with the closest relationship with A. faecalis and A. aquatilis (96% nucleotide similarity maximum). Degenerate PCR resulted in a 248-bp sequence showing 93% similarity with glpK of Candidatus Sodalis pierantonius SOPE, a key gene involved in glycerol metabolism. In vitro glycerol utilization test result showed that Alcaligenes sp. JG3 was able to grow on glycerol aerobically, but not anaerobically. It is concluded that Alcaligenes sp. JG3 possesses genes coding for glycerol metabolism and this trait is phenotypically expressed, thus making the strain potential to be used as an effective fat and oil biodegrader

ISOLASI BAKTERI PENGHASIL ENZIM PROTEASE BACILLUS AMYLOLIQUEFACIENS IROD2 PADA ONCOM MERAH PASCA FERMENTASI 48 JAM

Proteolytic  bacteria  are  the  bacteria  capable  of  producing  extracellular protease enzymes, namely protein-breaking enzymes that are widely used in many industrial fields. This study aimed to isolate a proteolytic bacterium found on 48-h post-fermented oncom and molecular identification method. The initial isolation and purification process of the colony was carried out using Nutrient Agar medium. Selection of protease enzyme obtained by bacterial isolate was done on Milk Skim Agar medium. Identification process of the isolate was done through amplification of 16S rRNA gene using PCR, sequencing and analysis of gene sequences using BLAST program. From the isolation process  a bacterial isolate that has proteolytic by the ability to produce a clear zone of 82.00 on plate. The result of the 16S rRNA gene sequence analysis showed that the proteolytic bacterial isolate obtained in this study had a 98% homology level with 16S ribosomal RNA isolate of Bacillus amyloliquefaciens strain A1142 (Genbank access code: KTT722836.1). Based on the results of the molecular identification, the isolate was identified as Bacillus amyloliquefaciens strain IROD2  (IROD2 = Indonesia Red Oncom Day2). As conclusion, from 48-h post fermented red oncom, a protease producing bacterial strain molecularly identified as Bacillus amyloliquefaciens strain IROD2. Keywords: Moleculary was identified, Proteolitic bacteria, 16S rRNA gen