Extracellular Membrane Vesicles and Immune Regulation in the Brain

The brain is characterized by a complex and integrated network of interacting cells in which cell-to-cell communication is critical for proper development and function. Initially considered as an immune privileged site, the brain is now regarded as an immune specialized system. Accumulating evidence reveals the presence of immune components in the brain, as well as extensive bidirectional communication that takes place between the nervous and the immune system both under homeostatic and pathological conditions. In recent years the secretion of extracellular membrane vesicles (EMVs) has been described as a new and evolutionary well-conserved mechanism of cell-to-cell communication, with EMVs influencing the microenvironment through the traffic of bioactive molecules that include proteins and nucleic acids, such as DNA, protein coding, and non-coding RNAs. Increasing evidence suggests that EMVs are a promising candidate to study cross-boundary cell-to-cell communication pathways. Herein we review the role of EMVs secreted by neural cells in modulating the immune response(s) within the brain under physiological and pathological circumstances

Substituted dipyridophenazine complexes of Cr(III): synthesis, enantiomeric resolution and binding interactions with calf thymus DNA

[Cr(phen)2(X2dppz)]3+ {X = H, Me, or F} have been synthesised, characterised, and chromatographically resolved into their constituent Δ and Λ enantiomers. The DNA-binding interactions of each of the racemic complexes were investigated, with the results of linear dichroism, thermal denaturation, and emission quenching studies indicative of intercalative binding to CT-DNA with a significant electrostatic contribution. UV/Vis absorption titrations suggest strong DNA binding by each of the racemic complexes, with the methylated analogue [Cr(phen)2(Me 2dppz)]3+ exhibiting the largest equilibrium binding constant. Emission quenching and UV-Vis titrations of the enantiomers of [Cr(phen)2(dppz)]3+ imply similar binding affinities for the Δ and Λ isomers, although significant differences between the circular dichroism spectra of the enantiomers in the presence of DNA connote differences in binding orientation and/or conformation between the two

RNA Nanotherapeutics for the Amelioration of Astroglial Reactivity.

In response to injuries to the CNS, astrocytes enter a reactive state known as astrogliosis, which is believed to be deleterious in some contexts. Activated astrocytes overexpress intermediate filaments including glial fibrillary acidic protein (GFAP) and vimentin (Vim), resulting in entangled cells that inhibit neurite growth and functional recovery. Reactive astrocytes also secrete inflammatory molecules such as Lipocalin 2 (Lcn2), which perpetuate reactivity and adversely affect other cells of the CNS. Herein, we report proof-of-concept use of the packaging RNA (pRNA)-derived three-way junction (3WJ) motif as a platform for the delivery of siRNAs to downregulate such reactivity-associated genes. In vitro, siRNA-3WJs induced a significant knockdown of Gfap, Vim, and Lcn2 in a model of astroglial activation, with a concomitant reduction in protein expression. Knockdown of Lcn2 also led to reduced protein secretion from reactive astroglial cells, significantly impeding the perpetuation of inflammation in otherwise quiescent astrocytes. Intralesional injection of anti-Lcn2-3WJs in mice with contusion spinal cord injury led to knockdown of Lcn2 at mRNA and protein levels in vivo. Our results provide evidence for siRNA-3WJs as a promising platform for ameliorating astroglial reactivity, with significant potential for further functionalization and adaptation for therapeutic applications in the CNS.The authors wish to acknowledge J. Bernstock and G. Pluchino for their critical insights throughout the execution of the study. This work was funded by the European Research Council (ERC) under the ERC-2010-StG grant agreement n° 260511-SEM_SEM, the Bascule Charitable Trust (RG 75149 to SP), the International Foundation for Research in Paraplegia (RG 69318 to S.P.), Wings for Life (RG 82921 to S.P.) and a core support grant from the Wellcome Trust and Medical Research Council to the Wellcome Trust – MRC Cambridge Stem Cell Institute. LPJ was supported by a research training fellowship from the Wellcome Trust (RRZA/057 RG79423)

Stem Cell Therapies for Progressive Multiple Sclerosis.

Multiple sclerosis (MS) is a chronic inflammatory disease of the central nervous system characterized by demyelination and axonal degeneration. MS patients typically present with a relapsing-remitting (RR) disease course, manifesting as sporadic attacks of neurological symptoms including ataxia, fatigue, and sensory impairment. While there are several effective disease-modifying therapies able to address the inflammatory relapses associated with RRMS, most patients will inevitably advance to a progressive disease course marked by a gradual and irreversible accrual of disabilities. Therapeutic intervention in progressive MS (PMS) suffers from a lack of well-characterized biological targets and, hence, a dearth of successful drugs. The few medications approved for the treatment of PMS are typically limited in their efficacy to active forms of the disease, have little impact on slowing degeneration, and fail to promote repair. In looking to address these unmet needs, the multifactorial therapeutic benefits of stem cell therapies are particularly compelling. Ostensibly providing neurotrophic support, immunomodulation and cell replacement, stem cell transplantation holds substantial promise in combatting the complex pathology of chronic neuroinflammation. Herein, we explore the current state of preclinical and clinical evidence supporting the use of stem cells in treating PMS and we discuss prospective hurdles impeding their translation into revolutionary regenerative medicines

Peptide based drug delivery systems to the brain

Abstract: With estimated worldwide cost over $1 trillion just for dementia, diseases of the central nervous system pose a major problem to health and healthcare systems, with significant socio-economic implications for sufferers and society at large. In the last two decades, numerous strategies and technologies have been developed and adapted to achieve drug penetration into the brain, evolving alongside our understanding of the physiological barriers between the brain and surrounding tissues. The blood brain barrier (BBB) has been known as the major barrier for drug delivery to the brain. Both invasive and minimally-invasive approaches have been investigated extensively, with the minimally-invasive approaches to drug delivery being more suitable. Peptide based brain targeting has been explored extensively in the last two decades. In this review paper, we focused on self-assembled peptides, shuttle peptides and nanoparticles drug delivery systems decorated/conjugated with peptides for brain penetration

Measuring nickel masses in Type Ia supernovae using cobalt emission in nebular phase spectra

The light curves of Type Ia supernovae (SNe Ia) are powered by the radioactive decay of $^{56}$Ni to $^{56}$Co at early times, and the decay of $^{56}$Co to $^{56}$Fe from ~60 days after explosion. We examine the evolution of the [Co III] 5892 A emission complex during the nebular phase for SNe Ia with multiple nebular spectra and show that the line flux follows the square of the mass of $^{56}$Co as a function of time. This result indicates both efficient local energy deposition from positrons produced in $^{56}$Co decay, and long-term stability of the ionization state of the nebula. We compile 77 nebular spectra of 25 SN Ia from the literature and present 17 new nebular spectra of 7 SNe Ia, including SN2014J. From these we measure the flux in the [Co III] 5892 A line and remove its well-behaved time dependence to infer the initial mass of $^{56}$Ni ($M_{Ni}$) produced in the explosion. We then examine $^{56}$Ni yields for different SN Ia ejected masses ($M_{ej}$ - calculated using the relation between light curve width and ejected mass) and find the $^{56}$Ni masses of SNe Ia fall into two regimes: for narrow light curves (low stretch s~0.7-0.9), $M_{Ni}$ is clustered near $M_{Ni}$ ~ 0.4$M_\odot$ and shows a shallow increase as $M_{ej}$ increases from ~1-1.4$M_\odot$; at high stretch, $M_{ej}$ clusters at the Chandrasekhar mass (1.4$M_\odot$) while $M_{Ni}$ spans a broad range from 0.6-1.2$M_\odot$. This could constitute evidence for two distinct SN Ia explosion mechanisms.Comment: 16 pages, 12 figures (main text), plus data tables in appendix. Spectra released on WISeREP. Submitted to MNRAS, comments welcom

Neural stem cells traffic functional mitochondria via extracellular vesicles.

Neural stem cell (NSC) transplantation induces recovery in animal models of central nervous system (CNS) diseases. Although the replacement of lost endogenous cells was originally proposed as the primary healing mechanism of NSC grafts, it is now clear that transplanted NSCs operate via multiple mechanisms, including the horizontal exchange of therapeutic cargoes to host cells via extracellular vesicles (EVs). EVs are membrane particles trafficking nucleic acids, proteins, metabolites and metabolic enzymes, lipids, and entire organelles. However, the function and the contribution of these cargoes to the broad therapeutic effects of NSCs are yet to be fully understood. Mitochondrial dysfunction is an established feature of several inflammatory and degenerative CNS disorders, most of which are potentially treatable with exogenous stem cell therapeutics. Herein, we investigated the hypothesis that NSCs release and traffic functional mitochondria via EVs to restore mitochondrial function in target cells. Untargeted proteomics revealed a significant enrichment of mitochondrial proteins spontaneously released by NSCs in EVs. Morphological and functional analyses confirmed the presence of ultrastructurally intact mitochondria within EVs with conserved membrane potential and respiration. We found that the transfer of these mitochondria from EVs to mtDNA-deficient L929 Rho0 cells rescued mitochondrial function and increased Rho0 cell survival. Furthermore, the incorporation of mitochondria from EVs into inflammatory mononuclear phagocytes restored normal mitochondrial dynamics and cellular metabolism and reduced the expression of pro-inflammatory markers in target cells. When transplanted in an animal model of multiple sclerosis, exogenous NSCs actively transferred mitochondria to mononuclear phagocytes and induced a significant amelioration of clinical deficits. Our data provide the first evidence that NSCs deliver functional mitochondria to target cells via EVs, paving the way for the development of novel (a)cellular approaches aimed at restoring mitochondrial dysfunction not only in multiple sclerosis, but also in degenerative neurological diseases

No evidence that footedness in pheasants influences cognitive performance in tasks assessing colour discrimination and spatial ability

The differential specialization of each side of the brain facilitates the parallel processing of information and has been documented in a wide range of animals. Animals that are more lateralized as indicated by consistent preferential limb use are commonly reported to exhibit superior cognitive ability as well as other behavioural advantages.We assayed the lateralization of 135 young pheasants (Phasianus colchicus), indicated by their footedness in a spontaneous stepping task, and related this measure to individual performance in either 3 assays of visual or spatial learning and memory. We found no evidence that pronounced footedness enhances cognitive ability in any of the tasks. We also found no evidence that an intermediate footedness relates to better cognitive performance. This lack of relationship is surprising because previous work revealed that pheasants have a slight population bias towards right footedness, and when released into the wild, individuals with higher degrees of footedness were more likely to die. One explanation for why extreme lateralization is constrained was that it led to poorer cognitive performance, or that optimal cognitive performance was associated with some intermediate level of lateralization. This stabilizing selection could explain the pattern of moderate lateralization that is seen in most non-human species that have been studied. However, we found no evidence in this study to support this explanation

Dinuclear polypyridyl ruthenium(II) complexes as stereoselective probes of nucleic acid secondary structures

This thesis reports on the nucleic acid-binding properties of a series of dinuclear\ud polypyridylruthenium(II) complexes of the general form [{Ru(pp)2}2(μ-BL)]4+ {where pp =\ud 2,2′-bipyridine (bpy), 4,4′-dimethyl-2,2′-bipyridine (Me2bpy), 5,5′-dimethyl-2,2′-bipyridine\ud (5,5′-Me2bpy), 1,10-phenanthroline (phen), and 4,7-dimethyl-1,10-phenanthroline (Me2phen);\ud BL = 2,2′-bipyrimidine (bpm), 1,4,5,8,9,12-hexaazatriphenylene (HAT), 1,4,5,12-\ud tetraazatriphenylene (4,7-phenanthrolino-5,6:5′,6′-pyrazine; ppz), 2,3-bis(2-pyridyl)pyrazine\ud (2,3-dpp), and 2,5-bis(2-pyridyl)pyrazine (2,5-dpp)}. These complexes encompass three\ud general geometries as governed by their bridging ligands – “linear” (bpm), “angular” (HAT,\ud ppz, 2,3-dpp) and “stepped-parallel” (2,5-dpp) – and incorporate a systematic variation of\ud terminal ligand hydrophobicity and bulk. The stereoisomers of each complex were isolated by\ud means of cation-exchange chromatography and characterisation was achieved using 1H NMR\ud and CD spectroscopy.\ud \ud Fluorescent Intercalator Displacement (FID) assays were used to survey to relative binding\ud affinities of this array of complexes to a library of oligonucleotides incorporating a variety of\ud different duplex, bulge, hairpin loop and quadruplex-forming sequences. Notable trends were\ud observed with respect to terminal ligand identity (increased hydrophobicity typically correlated\ud to stronger binding), bridging ligand identity (the “angular” class of complex was usually the\ud strongest binding), and stereochemistry (the meso diastereoisomer of a given complex typically\ud demonstrated the greatest affinity). Additionally, the metal complexes generally demonstrated a\ud heightened affinity for more open oligonucleotide structures such as bulges and loops, as well\ud as AT-rich duplex sequences.\ud \ud A small number of discrepancies were noted in the results of the FID assays wherein the\ud relative order of binding affinity implied by the FID assay contradicted that suggested by other\ud experiments (NMR, equilibrium dialysis, affinity chromatography). These discrepancies were\ud rectified by replacing the intercalating dye used in the assay (ethidium bromide) with the minor\ud groove-binder DAPI (4′,6-diamidino-2-phenylindole), the binding mode of which more closely\ud resembles that of the metal complexes being investigated.\ud \ud Electronic absorption titration experiments conducted with several of the complexes and\ud calf thymus DNA confirmed the correlations between ligand identity and stereochemistry seen in the FID (and modified DAPI-displacement) assays. Intrinsic binding constants obtained from\ud these titrations were within the range of mid-104 to low-105 M-1, consistent with previously\ud published values for dinuclear complex-calf thymus DNA interactions. Analogous titrations\ud using yeast tRNA yielded binding constants of a similar magnitude, but in these experiments no\ud clear relationship was evident between the nature of a given complex and its binding affinity.\ud One- and two-dimensional NMR experiments were used to probe in greater detail several\ud of the more notable metal complex-oligonucleotide interactions (as implied by the results of the\ud FID assays). These experiments confirmed the minor groove-binding nature of this genre of\ud metal complex and reaffirmed the oligonucleotide selectivities implied by the FID assays.\ud [{Ru(bpy)2}2(μ-bpm)]4+ and [{Ru(Me2bpy)2}2(μ-bpm)]4+ were found to bind poorly to a duplex\ud control sequence {d(CCGGAATTCCGG)2} and relatively weakly to the analogous sequence\ud possessing a single-base bulge {d(CCGAGAATTCCGG)2} and an octadecanucleotide\ud containing a four-base hairpin loop {d(CACTGGTCTCTACCAGTG)}, all consistent with the\ud affinities demonstrated by these particular complexes in the FID experiments. Conversely, the\ud meso diastereoisomers of [{Ru(phen)2}2(μ-HAT)]4+ and [{Ru(Me2phen)2}2(μ-HAT)]4+\ud confirmed their strong affinities to a six-base hairpin loop sequence {d(CACTGGTCTCTCTACCAGTG)}. Each complex bound strongly to the stem-loop\ud interface of the icosanucleotide as evidenced by selective broadening of T-methyl and aromatic\ud resonances corresponding to protons within the loop/stem-loop interface. The extent of\ud broadening observed in these NMR experiments, coupled with the performance of each\ud complex in the FID assays, suggests a stronger yet less selective interaction by the Me2phenversion\ud of the complex. This significant broadening of both the icosanucleotide and metal\ud complex spectra prohibited a thorough NOESY characterisation of the binding, but the few\ud NOE signals that were obtained confirmed binding of the complexes at the stem-loop interface\ud and facilitated the construction of molecular models of each interaction.\ud \ud NMR experiments were also used to investigate the unexpectedly-favourable association\ud meso-[{Ru(phen)2}2(μ-ppz)]4+ and the duplex oligonucleotide sequence\ud d(ATATATATATAT)2. Again, both the metal complex and oligonucleotide spectra exhibited\ud significant broadening upon interaction, suggesting moderate-to-strong binding. Furthermore,\ud several resonances corresponding to terminal phenanthroline ligand protons underwent large\ud upfield shifts. NOESY spectra revealed many strong NOE interactions between the terminal\ud ligands of the complex and minor groove sugar resonances, assisting the development of a binding model. The high selectivity of meso-[{Ru(phen)2}2(μ-ppz)]4+ for AT-rich regions of\ud duplex DNA was confirmed using a restriction enzyme inhibition assay wherein the metal\ud complex was found to interfere with the action of a restriction endonuclease that cuts doublestranded\ud DNA at the center of a TATA sequence.\ud \ud The impressive selectivity inherent in many of these oligonucleotide-metal complex\ud interactions has been exploited in the development of a DNA-based affinity chromatography\ud technique for the highly efficient separation of different polypyridylruthenium(II) complexes,\ud as well as the stereoisomers of individual complexes. Separations requiring effective column\ud lengths in excess of 30 m on a cation-exchange column have been replicated using a column\ud length of less than 5 cm. This technique has proven useful in qualitatively establishing relative\ud binding affinities between complexes and a variety of oligonucleotides (duplex and nonduplex),\ud and was one of the tools used to confirm the validity of the DAPI-modified fluorescent\ud dye-displacement assay.\ud \ud These studies demonstrate the utility of this genre of rigid dinuclear metal complexes as\ud sequence- and structure-selective probes of nucleic acids. Honing and targeting this selectivity\ud to specific biologically-relevant targets through a rational choice of ligands, functionality and\ud stereochemistry may potentially yield a new generation of more efficacious diagnostic and\ud therapeutic agents

Separation of stereoisomers of dinuclear metal complexes by binding affinity chromatography using non-duplex DNA

Affinity chromatography – using non-duplex DNA as the affinity ligand – has been used as a highly efficient means of separating stereoisomers of dinuclear polypyridyl ruthenium(II) complexes