Nature-inspired Cuckoo Search Algorithm for Side Lobe Suppression in a Symmetric Linear Antenna Array

In this paper, we proposed a newly modified cuckoo search (MCS) algorithm integrated with the Roulette wheel selection operator and the inertia weight controlling the search ability towards synthesizing symmetric linear array geometry with minimum side lobe level (SLL) and/or nulls control. The basic cuckoo search (CS) algorithm is primarily based on the natural obligate brood parasitic behavior of some cuckoo species in combination with the Levy flight behavior of some birds and fruit flies. The CS metaheuristic approach is straightforward and capable of solving effectively general N-dimensional, linear and nonlinear optimization problems. The array geometry synthesis is first formulated as an optimization problem with the goal of SLL suppression and/or null prescribed placement in certain directions, and then solved by the newly MCS algorithm for the optimum element or isotropic radiator locations in the azimuth-plane or xy-plane. The study also focuses on the four internal parameters of MCS algorithm specifically on their implicit effects in the array synthesis. The optimal inter-element spacing solutions obtained by the MCS-optimizer are validated through comparisons with the standard CS-optimizer and the conventional array within the uniform and the Dolph-Chebyshev envelope patterns using MATLABTM. Finally, we also compared the fine-tuned MCS algorithm with two popular evolutionary algorithm (EA) techniques include particle swarm optimization (PSO) and genetic algorithms (GA)

IoT-based BIM integrated model for energy and water management in smart homes

Increasing urbanization and growth in infrastructure create a demand to utilize modern tools to manage human needs. Effective integration of the Internet of Things (IoT) into the design of smart homes is an actively growing area in the construction industry. The ever-increasing demand and cost of energy require a smart solution in the design stage by the construction industry. It is possible to reduce household energy consumption by utilizing energy-efficient sustainable materials in infrastructure construction. Building Information Modeling (BIM) can provide a solution to effectively manage energy. The integration of the IoT further improves the design of comfortable smart homes by utilizing natural lighting. BIM aids in determining energy efficiency and making decisions by presenting the user with several design options via the 6D method. The present study considered a sample home design following the National Building Code (NBC) and American Society of Heating, Refrigerating, and Air Conditioning Engineers (ASHRAE) standards for implementation. Natural lighting analysis is carried out with the tool Insight 360 to analyze the energy consumption of the building. Some of the outputs obtained from the analysis are wall-to-window ratio (WWR), window shades, design options for window glass, energy use intensity (EUI), and annual energy cost (AEC). The results of the outputs are compared to find the energy-efficient optimum natural lighting of the proposed building. The lesser EUI (16%–21%) and AEC (23%–28%) are identified with the utilization of low emissivity glass in window panels compared with other types of glass. The proposed IoT-based BIM integration model proves that the effective utilization of natural lighting reduces overall household energy consumption

Phosphatidylinositol 3-kinase δ blockade increases genomic instability in B cells

Activation-induced cytidine deaminase (AID) is a B-cell specific enzyme that targets immunoglobulin (Ig) genes to initiate class switch recombination (CSR) and somatic hypermutation (SHM)(1). Through off-target activity, however, AID has a much broader impact on genomic instability by initiating oncogenic chromosomal translocations and mutations involved in lymphoma development and progression(2). AID expression is tightly regulated in B cells and its overexpression leads to enhanced genomic instability and lymphoma formation(3). The phosphatidylinositol 3-kinase (PI3K) δ pathway plays a key role in AID regulation by suppressing its expression in B cells(4). Novel drugs for leukemia or lymphoma therapy such as idelalisib, duvelisib or ibrutinib block PI3Kδ activity directly or indirectly(5–8), potentially affecting AID expression and, consequently, genomic stability in B cells. Here we show that treatment of primary mouse B cells with idelalisib or duvelisib, and to a lesser extent ibrutinib, enhanced the expression of AID and increased somatic hypermutation (SHM) and chromosomal translocation frequency to the Igh locus and to several AID off-target sites. Both these effects were completely abrogated in AID deficient B cells. PI3Kδ inhibitors or ibrutinib increased the formation of AID-dependent tumors in pristane-treated mice. Consistently, PI3Kδ inhibitors enhanced AID expression and translocation frequency to IgH and AID off-target sites in human chronic lymphocytic leukemia (CLL) and mantle cell lymphoma (MCL) cell lines, and patients treated with idelalisib, but not ibrutinib, showed increased SHM in AID off-targets. In summary, we show that PI3Kδ or BTK inhibitors increase genomic instability in normal and neoplastic B cells by an AID-dependent mechanism, an effect that should be carefully considered as such inhibitors are administered for years to patients

Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations

Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten β- and 2 previously reported α-globin defects were identified. The Fil-ipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the –α 3.7 /αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. Conclusion: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations

Unmet needs of patients with chronic obstructive pulmonary disease (COPD): A qualitative study on patients and doctors

Background: Chronic Obstructive Pulmonary Disease (COPD) is a chronic disease with repeated exacerbations resulting in gradual debilitation. The quality of life has been shown to be poor in patients with COPD despite efforts to improve self-management. However, the evidence on the benefit of self-management in COPD is conflicting. Whether this could be due to other unmet needs of patients have not been investigated. Therefore, we aimed to explore unmet needs of patients from both patients and doctors managing COPD. Methods: We conducted a qualitative study with doctors and patients in Malaysia. We used convenience sampling to recruit patients until data saturation. Eighteen patients and eighteen doctors consented and were interviewed using a semi-structured interview guide. The interviews were audio-recorded, transcribed verbatim and checked by the interviewers. Data were analysed using a thematic approach. Results: The themes were similar for both the patients and doctors. Three main themes emerged: knowledge and awareness of COPD, psychosocial and physical impact of COPD and the utility of self-management. Knowledge about COPD was generally poor. Patients were not familiar with the term chronic obstructive pulmonary disease or COPD. The word ‘asthma’ was used synonymously with COPD by both patients and doctors. Most patients experienced difficulties in their psychosocial and physical functions such as breathlessness, fear and helplessness. Most patients were not confident in self-managing their illness and prefer a more passive role with doctors directing their care. Conclusions: In conclusion, our study showed that knowledge of COPD is generally poor. There was mislabelling of COPD as asthma by both patients and physicians. This could have resulted in the lack of understanding of treatment options, outcomes, and prognosis of COPD. The misconception that cough due to COPD was contagious, and breathlessness that resulted from COPD, had important physical and psychosocial impact, and could lead to social isolation. Most patients and physicians did not favour self-management approaches, suggesting innovations based on self-management may be of limited benefit

Ethnic Differences in Survival after Breast Cancer in South East Asia

Background: The burden of breast cancer in Asia is escalating. We evaluated the impact of ethnicity on survival after breast cancer in the multi-ethnic region of South East Asia. Methodology/Principal Findings Using the Singapore-Malaysia hospital-based breast cancer registry, we analyzed the association between ethnicity and mortality following breast cancer in 5,264 patients diagnosed between 1990 and 2007 (Chinese: 71.6%, Malay: 18.4%, Indian: 10.0%). We compared survival rates between ethnic groups and calculated adjusted hazard ratios (HR) to estimate the independent effect of ethnicity on survival. Malays (n = 968) presented at a significantly younger age, with larger tumors, and at later stages than the Chinese and Indians. Malays were also more likely to have axillary lymph node metastasis at similar tumor sizes and to have hormone receptor negative and poorly differentiated tumors. Five year overall survival was highest in the Chinese women (75.8%; 95%CI: 74.4%–77.3%) followed by Indians (68.0%; 95%CI: 63.8%–72.2%), and Malays (58.5%; 95%CI: 55.2%–61.7%). Compared to the Chinese, Malay ethnicity was associated with significantly higher risk of all-cause mortality (HR: 1.34; 95%CI: 1.19–1.51), independent of age, stage, tumor characteristics and treatment. Indian ethnicity was not significantly associated with risk of mortality after breast cancer compared to the Chinese (HR: 1.14; 95%CI: 0.98–1.34). Conclusion: In South East Asia, Malay ethnicity is independently associated with poorer survival after breast cancer. Research into underlying reasons, potentially including variations in tumor biology, psychosocial factors, treatment responsiveness and lifestyle after diagnosis, is warranted

General anaesthetic and airway management practice for obstetric surgery in England: a prospective, multi-centre observational study

There are no current descriptions of general anaesthesia characteristics for obstetric surgery, despite recent changes to patient baseline characteristics and airway management guidelines. This analysis of data from the direct reporting of awareness in maternity patients' (DREAMY) study of accidental awareness during obstetric anaesthesia aimed to describe practice for obstetric general anaesthesia in England and compare with earlier surveys and best-practice recommendations. Consenting patients who received general anaesthesia for obstetric surgery in 72 hospitals from May 2017 to August 2018 were included. Baseline characteristics, airway management, anaesthetic techniques and major complications were collected. Descriptive analysis, binary logistic regression modelling and comparisons with earlier data were conducted. Data were collected from 3117 procedures, including 2554 (81.9%) caesarean deliveries. Thiopental was the induction drug in 1649 (52.9%) patients, compared with propofol in 1419 (45.5%). Suxamethonium was the neuromuscular blocking drug for tracheal intubation in 2631 (86.1%), compared with rocuronium in 367 (11.8%). Difficult tracheal intubation was reported in 1 in 19 (95%CI 1 in 16-22) and failed intubation in 1 in 312 (95%CI 1 in 169-667). Obese patients were over-represented compared with national baselines and associated with difficult, but not failed intubation. There was more evidence of change in practice for induction drugs (increased use of propofol) than neuromuscular blocking drugs (suxamethonium remains the most popular). There was evidence of improvement in practice, with increased monitoring and reversal of neuromuscular blockade (although this remains suboptimal). Despite a high risk of difficult intubation in this population, videolaryngoscopy was rarely used (1.9%)

Application of terrestrial lidar for biological monitoring

In this paper, the terrestrial LIDAR method was utilised to conduct two biological monitoring studieson fauna and flora monitoring. In the first study, we utilised terrestrial LIDAR to conduct a populationcount of roosting bats where prior methodologies in censuring roosting bats involves direct roostcount for single individuals or small clusters while larger clusters are estimated by multiplying of thesmaller clusters. Visual counting methods includes emergence counts, dispersal counts anddisturbance counts during daylight or crepuscular conditions, often with an optical-mechanicalmethods for species confirmation such as acoustic bat detector, infrared cameras, thermal images andradar systems. Using LIDAR, we generated millions of high resolution “point clouds” that created a3D image of the bats and the cave thus producing a high resolution image of each bat without directcontact. We can spatially analyse the three dimensional distribution of bats populations as well asgenerate a 3D topological structure of the cave that the bats dwell in, thus providing a high resolutionmodel of the cave and an accurate count of the bats and their roosting pattern. In the second study, weused terrestrial LIDAR to rapidly and remotely determine the diameter at breast height (DBH) of rubber trees. Conventional measuring method is time consuming and labour intensive as the DBH hasto be measured by going to every single tree. The LIDAR scanned effectively measured the DBH of the trees in the scanning path, enabling high resolution measurements (2 mm), location and thetopology of the landscape be captured for data analysis. The laser point clouds density was sufficientto extract information and the scanner easily deployable in the field. Repeated scans will allowtemporal comparison of the growth of the rubber trees by overlapping the point clouds data. We haveshown that terrestrial LIDAR is able to provide a novel methodology in biological studies and itsdeployability, accuracy and speed would make it a useful research tool in the future

Effect of column size on the seismic capacity of elevated reinforced concrete water tank

Elevated reinforced concrete water tanks are one of the most essential structure to major cities and also in rural areas before, during and after a disaster such earthquake. It is important to prevent elevated reinforced concrete water tank from collapse so the water supply can be maintained. One of the methods used to evaluate the seismic capacity of elevated reinforced concrete water tank is the pushover analysis. Pushover analysis is based on the assumption that structure oscillate predominantly in the first mode or in the lower modes of vibration during a seismic event. The objective of this project is to study the effect of column size on the seismic capacity of elevated reinforced concrete water tank. A total number of 10 models of elevated reinforced concrete water tanks consist of 4 storey and 7 storey has been used for this project. All models have been designed repeatedly to 5 different size of column for each storey, where the beam size is fixed for each model. All models have been designed based on BS8110 to represent the existing elevated reinforced concrete water tanks. Then the pushover analysis has been conducted on all models to study the seismic capacity of elevated reinforced concrete water tank. An adequate information on seismic demands imposed on the structural system and its components by the designed ground motion will be provided from the pushover analysis. Based on the pushover analysis conducted in this study, the elevated RC water tank with larger size of column tend to have higher value of force at yield limit state and ultimate limit state