Narcissistic Personality Disorder: Are Psychodynamic Theories and the Alternative DSM-5 Model for Personality Disorders Finally Going to Meet?

Narcissistic Personality Disorder is the new borderline personality disorder of our current era. There have been recent developments on narcissism that are certainly worthwhile examining. Firstly, relational and intersubjective psychoanalysts have been rethinking the underlying concepts of narcissism, focusing on the development of self and relations to others. Secondly, in the DSM-5, the Alternative DSM-5 Model for Personality Disorders (AMPD) was presented for a dimensional evaluation of the severity of personality disorder pathology. The combined dimensional and trait conceptualization of NPD opened the door to new integrated diagnostic perspectives, including both internal and interpersonal functioning. Finally, Pincus and Lukowitsky encourage clinicians to use a hierarchical model of pathological narcissism, as it opens up opportunities for shared points of interest in empirical research from different scholarly perspectives. As for most non-psychodynamic clinicians and researchers the DSM-5 clearly bears dominant weight in their work, we will take the AMPD model for NPD as our point of reference. We will discuss the narcissist's unique pattern of self-impairments in identity and self-direction, and of interpersonal disfunctioning (evaluated by assessing empathy and intimacy). Subsequently, we will examine how contemporary psychodynamic theories and the hierarchical model of Pincus and Lukowitsky additionally inform or contradict the AMPD. For us, one of the big advantages of the AMPD is the use of structured clinical evaluations of disturbances of the self and interpersonal functioning and the dimensional evaluation of severity. As psychodynamically oriented therapists, we are enthusiastic about the opportunities for inclusion of psychodynamic concepts, but we also discuss a number of sticking points

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of the wild-type strain and the DeltarecA mutant strain after exposure to the DNA damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin and streptomycin resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Subsequently, stress survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2), and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the hos

Immunohistochemical expression of SKALP/elafin in squamous cell carcinoma of the oesophagus.

In this study, the immunohistochemical expression of a new inducible elastase inhibitor, SKALP (skin-derived anti-leucoproteinase)/elafin, in the tissue of squamous cell carcinoma and uninvolved oesophageal mucosa was studied using a polyclonal rabbit anti-serum against SKALP/elafin. The results were compared with the immunohistochemical staining of proliferating cell nuclear antigen (PCNA) and the TUNEL assay in serial sections. In non-malignant oesophageal mucosa, the expression of SKALP/elafin was localized in the cells of the stratified zone overlying the PCNA-positive basal zone. In oesophageal cancer, the incidence of the expression was significantly related to the degree of the differentiation of the tumour. Characteristically, the expression was almost limited in tumour cell nests that had a clear squamous phenotype. In tumour cell nests, the expression of SKALP/elafin was localized in the cells overlying PCNA-expressing cells and no expression was found in the cells that expressed PCNA; DNA fragmentation was often observed in the same cell layers as those in which SKALP/elafin immunoreactivity was found. This enzyme inhibitor is speculated to be involved in the induction of the cell differentiation and apoptosis of human squamous cell carcinoma cells of the oesophagus

Synergistic effects of TNF-alpha and melphalan in an isolated limb perfusion model of rat sarcoma: a histopathological, immunohistochemical and electron microscopical study.

Isolated limb perfusion (ILP) with tumour necrosis factor alpha (TNF-alpha) and melphalan has shown impressive results in patients with irresectable soft tissue sarcomas and stage III melanoma of the extremities. The mechanisms of the reported in vivo synergistic anti-tumour effects of TNF-alpha and melphalan are not precisely understood. We have developed an ILP model in the rat using a non-immunogenic sarcoma in which similar in vivo synergy is observed. The aim of this present study was to analyse the morphological substrate for this synergistic response of TNF-alpha in combination with melphalan to shed more light on the pathomechanisms involved. Histology of the tumours from saline- (n = 14) and melphalan-treated (n = 11) rats revealed apparently vital tumour cells in over 80% of the cross-sections. Interstitial oedema and coagulation necrosis were observed in the remaining part of the tumour. Haemorrhage was virtually absent. TNF-alpha (n = 22) induced marked oedema, hyperaemia, vascular congestion, extravasation of erythrocytes and haemorrhagic necrosis (20-60% of the cross-sections). Oedema and haemorrhage suggested drastic alterations of permeability and integrity of the microvasculature. Using light and electron-microscopy, we observed that haemorrhage preceded generalised platelet aggregation. Therefore, we suggest that the observed platelet aggregation was the result of the microvascular damage rather than its initiator. Remarkably, these events hardly influenced tumour growth. However, perfusion with the combination of TNF-alpha and melphalan (n = 24) showed more extensive haemorrhagic necrosis (80-90% of the cross-sections) and revealed a prolonged remission (mean 11 days) in comparison with the other groups of rats. Electron microscopical analysis revealed similar findings as described after TNF-alpha alone, although the effects were more prominent at all time points after perfusion. In conclusion, our findings suggest that the enhanced anti-tumour effect after the combination of TNF-alpha with melphalan results from potentiation of the TNF-alpha-induced vascular changes accompanied by increased vascular permeability and platelet aggregation. This may result in additive cytotoxicity or inhibition of growth of residual tumour cells

Hepatic glucokinase regulatory protein and carbohydrate response element binding protein attenuation reduce de novo lipogenesis but do not mitigate intrahepatic triglyceride accumulation in Aldob deficiency

Objective: Stable isotope studies have shown that hepatic de novo lipogenesis (DNL) plays an important role in the pathogenesis of intrahepatic lipid (IHL) deposition. Furthermore, previous research has demonstrated that fructose 1-phosphate (F1P) not only serves as a substrate for DNL, but also acts as a signalling metabolite that stimulates DNL from glucose. The aim of this study was to elucidate the mediators of F1P-stimulated DNL, with special focus on two key regulators of intrahepatic glucose metabolism, i.e., glucokinase regulatory protein (GKRP) and carbohydrate response element binding protein (ChREBP).Methods: Aldolase B deficient mice (Aldob-/-), characterized by hepatocellular F1P accumulation, enhanced DNL, and hepatic steatosis, were either crossed with GKRP deficient mice (Gckr-/-) or treated with short hairpin RNAs directed against hepatic ChREBP.Results: Aldob-/- mice showed higher rates of de novo palmitate synthesis from glucose when compared to wildtype mice (p < 0.001). Gckr knockout reduced de novo palmitate synthesis in Aldob-/- mice (p = 0.017), without affecting the hepatic mRNA expression of enzymes involved in DNL. In contrast, hepatic ChREBP knockdown normalized the hepatic mRNA expression levels of enzymes involved in DNL and reduced fractional DNL in Aldob-/- mice (p < 0.05). Of interest, despite downregulation of DNL in response to Gckr and ChREBP attenuation, no reduction in intrahepatic triglyceride levels was observed.Conclusions: Both GKRP and ChREBP mediate F1P-stimulated DNL in aldolase B deficient mice. Further studies are needed to unravel the role of GKRP and hepatic ChREBP in regulating IHL accumulation in aldolase B deficiency

Anomalous Lattice Vibrations of Single and Few-Layer MoS2

Molybdenum disulfide (MoS2) of single and few-layer thickness was exfoliated on SiO2/Si substrate and characterized by Raman spectroscopy. The number of S-Mo-S layers of the samples was independently determined by contact-mode atomic-force microscopy. Two Raman modes, E12g and A1g, exhibited sensitive thickness dependence, with the frequency of the former decreasing and that of the latter increasing with thickness. The results provide a convenient and reliable means for determining layer thickness with atomic-level precision. The opposite direction of the frequency shifts, which cannot be explained solely by van der Waals interlayer coupling, is attributed to Coulombic interactions and possible stacking-induced changes of the intralayer bonding. This work exemplifies the evolution of structural parameters in layered materials in changing from the 3-dimensional to the 2-dimensional regime.Comment: 14 pages, 4 figure

Identification of novel functional sequence variants in the gene for peptidase inhibitor 3

BACKGROUND: Peptidase inhibitor 3 (PI3) inhibits neutrophil elastase and proteinase-3, and has a potential role in skin and lung diseases as well as in cancer. Genome-wide expression profiling of chorioamniotic membranes revealed decreased expression of PI3 in women with preterm premature rupture of membranes. To elucidate the molecular mechanisms contributing to the decreased expression in amniotic membranes, the PI3 gene was searched for sequence variations and the functional significance of the identified promoter variants was studied. METHODS: Single nucleotide polymorphisms (SNPs) were identified by direct sequencing of PCR products spanning a region from 1,173 bp upstream to 1,266 bp downstream of the translation start site. Fourteen SNPs were genotyped from 112 and nine SNPs from 24 unrelated individuals. Putative transcription factor binding sites as detected by in silico search were verified by electrophoretic mobility shift assay (EMSA) using nuclear extract from Hela and amnion cell nuclear extract. Deviation from Hardy-Weinberg equilibrium (HWE) was tested by χ(2 )goodness-of-fit test. Haplotypes were estimated using expectation maximization (EM) algorithm. RESULTS: Twenty-three sequence variations were identified by direct sequencing of polymerase chain reaction (PCR) products covering 2,439 nt of the PI3 gene (-1,173 nt of promoter sequences and all three exons). Analysis of 112 unrelated individuals showed that 20 variants had minor allele frequencies (MAF) ranging from 0.02 to 0.46 representing "true polymorphisms", while three had MAF ≤ 0.01. Eleven variants were in the promoter region; several putative transcription factor binding sites were found at these sites by database searches. Differential binding of transcription factors was demonstrated at two polymorphic sites by electrophoretic mobility shift assays, both in amniotic and HeLa cell nuclear extracts. Differential binding of the transcription factor GATA1 at -689C>G site was confirmed by a supershift. CONCLUSION: The promoter sequences of PI3 have a high degree of variability. Functional promoter variants provide a possible mechanism for explaining the differences in PI3 mRNA expression levels in the chorioamniotic membranes, and are also likely to be useful in elucidating the role of PI3 in other diseases

Erythematous nodes, urticarial rash and arthralgias in a large pedigree with NLRC4-related autoinflammatory disease, expansion of the phenotype

Autoinflammatory disorders (AID) are a heterogeneous group of diseases, characterized by an unprovoked innate immune response, resulting in recurrent or ongoing systemic inflammation and fever1-3. Inflammasomes are protein complexes with an essential role in pyroptosis and the caspase-1-mediated activation of the proinflammatory cytokines IL-1β, IL-17 and IL-18

Analysis of obstetric complications and uterine connective tissue in tenascin-X-deficient humans and mice

Tenascin-X (TNX) is a large, multi-domain, extracellular matrix glycoprotein. Complete deficiency of TNX in humans leads to a recessive form of Ehlers-Danlos syndrome (EDS), and TNX haploinsufficiency is a cause of hypermobility type EDS. EDS patients appear to have a higher risk of several complications during pregnancy, such as pelvic instability, premature rupture of membranes, and postpartum hemorrhage. Here, we present a study of genitourinary and obstetric complications in TNX-deficient women of reproductive age. We have found complications, such as uterus prolapses, that are in agreement with previous findings in other EDS types. In TNX knockout (KO) mice, we have observed mild pregnancy-related abnormalities. Morphological and immunohistological analysis of uterine tissues has not revealed obvious quantitative or spatial differences between TNX KO and wildtype mice with respect to collagen types I, III, V, and XII or elastic fibers. We conclude that TNX-deficient women are at risk of obstetric complications, but that TNX KO mice show only a mild phenotype. Furthermore, we show that TNX is involved in the stability of elastic fibers rather than in their initial deposition