Isolation, culturing and larval rearing of adult Barnacles - a Universal biofouler from Visakhapatnam coast on Artificial Panel (WIC) System.

70-74The most dominant species that has successful settlement on the panel system was observed is Amphibalanusamphitrite. Adults were cultured in the laboratory for releasing nauplii and were reared under laboratory conditions and used in settlement assay. The results of this study indicated that the Barnacle Amphibalanusamphitriteis the most common biofouling organism present on all the three types of materials used in the experiment, in the coastal region of Visakhapatnam harbor

Phylogenetic study of mangrove associate grass Myriostachya wightiana (Nees ex Steud.) Hook. f. using rbcL gene sequence

Myriostachya is a monotypic genus in the family Poaceae, with the only known species Myriostachya wightiana (Nees ex Steud.) Hook.f. It is a mangrove associate grass primarily distributed along the muddy streams and channels in intertidal mangrove swamps of India, Bangladesh, Sri Lanka, Myanmar, Thailand and Sumatra. Molecular identification and evolutionary studies of M. wightiana is unreported till now. Therefore, in this study, the phylogenetic analysis of M. wightiana was established with related family members by using chloroplast rbcL gene-based systematics. The molecular phylogeny was accomplished by DNA extraction, PCR amplification and sequencing of the rbcL gene and phylogenetic analysis. The genomic DNA was extract using the CTAB method and the rbcL gene amplification is by using the F-5IATGTCACCACAAACAGAAACTAAAGC3I and R-5ICTTCGGCACAAAATAAGAAACGATCTC3I primers. Phylogenetic analysis of M. wightiana was performed by multiple sequence alignment with UPGMA, and the Maximum-parsimony phylogenetic tree was constructed using MEGAX. Myriostachya wightiana rbcL gene sequence shows the highest similarity to Paspalum species, and in the phylogenetic tree M. wightiana has a close branch with Paspalum vaginatum. The evolutionary divergence from M. wightiana is maximum (0.49) to Sorghum propinquum and minimum (0.01) to Oryza officinalis and Oryza punctata. This study concluded that M. wightiana has a strong morphological and phylogenetic relationship with salt-tolerant Paspalum sp

Intelligent Malware Detection System

Malicious programs spy on users’ behavior and compromise their privacy. Unfortunately, existing techniques for detecting malware and analyzing unknown code samples are insufficient and have significant shortcomings. We observe that malicious information access and processing behavior is the fundamental trait of numerous malware categories breaching users’ privacy (including key loggers, password thieves, network sniffers, stealth backdoors, spyware and root kits), which separates these malicious applications from benign software. Commercial anti-virus software is unable to provide protection against newly launched (“zero-day”) malware. In this dissertation work, we propose a novel malware detection technique which is based on the analysis of byte-level file content. The proposed dissertation work will demonstrate the implementation of system for detection of various types of malware

Synthesis, Characterization, and Evaluation of the Antibacterial Activity of Allophylus serratus

Allophylus serratus mediated silver nanoparticles biosynthesis, characterization, and antimicrobial activity were described. The synthesis of silver nanoparticles was confirmed by visual observation: UV-Vis spectrum, X-ray diffraction (XRD), Scanning Electron Microscopy (SEM), Energy Dispersive Spectroscopy (EDS), and Fourier Transform Infra-Red (FTIR). UV-Vis spectroscopy studies showed that the absorption spectra of synthesized silver nanoparticles from leaf and callus extracts had absorbance peak range of 440 nm and 445 nm, respectively. The X-RD pattern revealed the presence of crystalline, dominantly spherical silver nanoparticles in the sample having size ranging from 42 to 50 nm. The XRD peaks 38.2°, 44.1°, 64.1°, and 77.0° for leaf extract and 38.1°, 44.3°, 64.5°, 77.5°, and 81.33° for callus extract can be assigned the plane of silver crystals (111), (200), (220), and (311), respectively, and indicate that the silver nanoparticles are face-centered, cubic, and crystalline in nature. SEM and EDS analysis also confirmed the presence of silver nanoparticles. The FTIR results showed the presence of some biomolecules in extracts that act as reducing and capping agent for silver nanoparticles biosynthesis. The synthesized silver nanoparticles showed significant antibacterial activity against Klebsiella pneumoniae and Pseudomonas aeruginosa

Hall Current Effects on Free Convection Casson Fluid Flow in a Rotating System with Convective Boundary Conditions and Constant Heat Source

In this paper we investigated an unsteady free convection flow of casson fluid bounded by a moving vertical flat plate in a rotating system with convective boundary conditions. The governing equations are solved analytically by using perturbation technique. Finally the effects of various dimensionless parameters like inclined angle, Casson parameter, Heat source and Suction parameter on velocity, temperature, friction factor and local Nusselt number are discussed with the help of graphs and tables. Through this study, it is found that increasing values of casson parameter reduces the velocity and increase in inclined magnetic field or hall current parameter enhances the velocity profiles. Keywords: Casson fluid, Rotation, inclined magnetic field, MHD, Heat source

Case series of clinical study and surgical management of atlanto axial dislocation our institute experience

Background: Atlantoaxial dislocation refers to a loss of stability between the atlas and axis (C1-C2), resulting in loss of normal articulation. Cervical spine C1-C2 motion segment is the most technically challenging.Methods: This is a prospective and retrospective Study which included 34 patients admitted in King George hospital, Andhra medical college, Visakhapatnam over the past two years (January 2014- January 2016) with AAD.Results: The age of the patients ranged from 3 to 60 years with mean age being 37.67 years. Commonest presenting sign is local tenderness at the back of upper cervical region in 91.17%. Most common procedure done was single sitting trans oral odontoid decompression with posterior occipito cervical fusion with occipital plate and C2, C4 polyaxial screws and lateral mass rods in 18 cases out of 34. The next common procedure performed was C1 lateral mass and C2 pars screw fixation 8 out of 34.Conclusions: Trans oral odentoidectomy and posterior ocipito cervical fusion is ideal and still holds good for irreducible AAD with  ventral compressive pathology

Epidemiology of type 2 diabetes: Indian scenario.

India leads the world with largest number of diabetic subjects earning the dubious distinction of being termed the "diabetes capital of the world". According to the Diabetes Atlas 2006 published by the International Diabetes Federation, the number of people with diabetes in India currently around 40.9 million is expected to rise to 69.9 million by 2025 unless urgent preventive steps are taken. The so called "Asian Indian Phenotype" refers to certain unique clinical and biochemical abnormalities in Indians which include increased insulin resistance, greater abdominal adiposity i.e., higher waist circumference despite lower body mass index, lower adiponectin and higher high sensitive C-reactive protein levels. This phenotype makes Asian Indians more prone to diabetes and premature coronary artery disease. At least a part of this is due to genetic factors. However, the primary driver of the epidemic of diabetes is the rapid epidemiological transition associated with changes in dietary patterns and decreased physical activity as evident from the higher prevalence of diabetes in the urban population. Even though the prevalence of microvascular complications of diabetes like retinopathy and nephropathy are comparatively lower in Indians, the prevalence of premature coronary artery disease is much higher in Indians compared to other ethnic groups. The most disturbing trend is the shift in age of onset of diabetes to a younger age in the recent years. This could have long lasting adverse effects on nation's health and economy. Early identification of at-risk individuals using simple screening tools like the Indian Diabetes Risk Score (IDRS) and appropriate lifestyle intervention would greatly help in preventing or postponing the onset of diabetes and thus reducing the burden on the community and the nation as a whole

Wigner delay time from a random passive and active medium

We consider the scattering of electron by a one-dimensional random potential (both passive and active medium) and numerically obtain the probability distribution of Wigner delay time ($\tau$). We show that in a passive medium our probability distribution agrees with the earlier analytical results based on random phase approximation. We have extended our study to the strong disorder limit, where random phase approximation breaks down. The delay time distribution exhibits the long time tail ($1/\tau^2$) due to resonant states, which is independent of the nature of disorder indicating the universality of the tail of the delay time distribution. In the presence of coherent absorption (active medium) we show that the long time tail is suppressed exponentially due to the fact that the particles whose trajectories traverse long distances in the medium are absorbed and are unlikely to be reflected.Comment: 13 pages RevTex, 5 EPS figures included, communicated to PR

Screening for resistance to gummy stem blight, powdery mildew and cucumber green mottle mosaic virus in bottle gourd [Lagenaria siceraria (Mol.) Standl.]

Investigations were carried out to identify the source of resistance in 67 bottle gourd genotypes for gummy stem blight, powdery mildew and cucumber green mottle mosaic virus (CGMMV) diseases, under natural field epiphytotic conditions. The genotypes BG-95 (105.13), BG-114-1 (131.04), BG-114-3 (208.81) and BG-77-6-1 (221.80) were resistant for gummy stem blight with low AUDPC values, while, BG-125-5 (232.22), BG-6-3 found (250.00), BG-125-4 (307.78), BG-8-1 (308.89), BG-125-2 (311.11) and BG-124-2 (423.33) resistant with low AUDPC values for powdery mildew. Further, the two genotypes such as IIHR-19 and BG- 131 showed field level resistance against CGMMV. The selected genotypes based on field evaluation were subjected for artificial screening under glass house conditions. The genotypes, recorded consistent resistant reactions were BG-114-3, BG-77-6-1 and BG-95 for gummy stem blight disease and BG-6-3, BG-8-1, BG-125-4 and BG-125-2 for powdery mildew. The stable and durable source of resistance identified for gummy stem blight and powdery mildew in bottle gourd genotypes will hasten the process of developing resistance varieties in bottle gourd

RP-HPLC analysis of phenolic antioxidant compound 6-gingerol from in vitro cultures of Zingiber officinale Roscoe

Relation between 6-gingerol content and antioxidant activity in in vitro grown cultures of ginger was studied. Reverse phase HPLC analysis revealed that rhizome derived callus culture and micropropagated plants produced lowest amount of 6-gingerol compare to conventionally grown plants. The antioxidant activity of extracts was determined using 1,1-diphenyl-2-picrylhydrazyl (DPPH) radical scavenging assay and Ferric Reducing power assay (FRAP) and correlated with the content of total phenolics and total flavonoids in the extracts. Strong correlation was found between antioxidant activity, total phenolics and 6- gingerol content