910 research outputs found

    Amniotic fluid from healthy term pregnancies does not harbor a detectable microbial community

    Get PDF
    Abstract Recent studies have conflicting data regarding the presence of intra-amniotic microbiota. Viral communities are increasingly recognized as important although overlooked components of the human microbiota. It is unknown if the developing fetus is exposed to a community of viruses (virome). Given the debate over the existence of an intra-amniotic microbial community and the importance of understanding how the infant gut is populated, we characterized the virome and bacterial microbiota of amniotic fluid from 24 uncomplicated term pregnancies using next-generation sequencing methods. Contrary to expectations, the bacterial microbiota of amniotic fluid was indistinguishable from contamination controls. Viral reads were sparse in the amniotic fluid, and we found no evidence of a core viral community across samples

    Dynamics and control of the satellite power system

    Get PDF
    An investigation of the dynamics and control problems specifically related to the Satellite Power System (SPS), to assess performance of selected control concepts, and to identify and initiate development of advanced control technology that would enhance feasibility and performance of the SPS system was made. The initial stages of the study are reported

    Observation of a Broad L=1 cqˉc\bar{q} State in BD+ππB^{-}\to D^{*+}\pi^{-}\pi^{-} at CLEO

    Full text link
    Using 4.7 fb^-1 of data taken at CESR at energies at and near the Upsilon(4S) we have studied the decay B- -> D{*+}pi-pi- (and its conjugate). We observe a new, broad charmed meson state, which we interpret as D_J(j=1/2), in its decay to D{*+}pi-. Our preliminary results indicate the mass and width of this L=1 state to be m = (2461 +41/-3} +/-10 +/-32) MeV and Gamma = (290 +101/-79 +/-26 +/-36) MeV, with the third uncertainty associated with the parameterization of the relative strong phases. In addition we have measured several new branching fractions of charged B mesons. All quoted results are preliminary.Comment: 7 pages postscript, also available through http://w4.lns.cornell.edu/public/CLN

    The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein

    Get PDF
    Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression.Publisher PDFPeer reviewe

    Eco-friendly or Eco-frenzy? A cost-benefit analysis of companies’ environmental decisions

    Get PDF
    The purpose of this paper is to evaluate and analyze the incremental costs of businesses becoming “green.” It answers the overarching question: are businesses becoming eco-friendly or eco-frenzy? For the purposes of this paper, eco-friendly is defined as companies that strive to be environmentally conscious. Conversely, companies that are eco-frenzy become environmentally conscious for the wrong reasons, such as gaining an environmental reputation. With the increase in popularity of corporate social responsibility (CSR) and the legal requirements related to environmental laws, more businesses have been incorporating the ideas of sustainability into their strategic positioning. At the start of the 21st century a disclosure framework for sustainability was created and guidelines of Global Reporting Initiative (GRI) were put into practice. Hence, companies are producing separate environmental and sustainable reports as part of their annual financial statements. These reports include the information of costs incurred and benefits and savings realized as a result of implementing environmental practices. A sample of four companies, Canon, IBM, Intel, and Texas Instrument’s 2008-2010, annual environmental reports were used as data for this study. The cost-benefit effects were analyzed and conclusions drawn. The results of this study reveal that IBM and Canon were eco-friendly while Intel and Texas Instruments showed an eco-frenzy correlation

    Effect of In Ovo Exposure to PCBs and Hg on Clapper Rail Bone Mineral Chemistry from a Contaminated Salt Marsh in Coastal Georgia

    Get PDF
    The effect of Hg and PCBs (Aroclor 1268) on bone characteristics was investigated in a population of Clapper Rails (Rallus longirostris) inhabiting contaminated and unimpacted estuarine marsh systems in coastal Georgia. Exposure to contaminants did not affect the length or weight of leg bones, but it significantly altered the chemical composition of the bone. Specifically, bone in the contaminated site had a higher Ca to P, and lower carbonate and acid phosphate content. These characteristics are typical of more mature bone mineral and indicate that toxicants have accelerated bone maturation. FTIR spectroscopy data revealed a dose dependent change in the crystallinity of bone mineral, and the relative proportion of specific PO4 groups in different molecular environments in the bone, with toxicants loads. These changes are most probably related to a hormonal alteration of the rate of bone remodelation induced by exposure to toxicant loads

    Studies on La2-xPrxCayBa2Cu4+yOz (0.1 < x < 0.5) type mixed oxide superconductors

    Full text link
    The La2-xPrxCayBa2Cu4+yOz (LaPrCaBCO) mixed oxides have been studied for their structural and superconducting properties using X-ray diffraction (XRD), d. c. resistivity, d. c. susceptibility and iodometric double titration. All the LaPrCaBCO samples for x = 0.1 - 0.5, exhibit tetragonal crystalline structure with P 4/mmm space group as determined by Rietveld analysis of the X-ray diffraction data. With increasing x, enhancement in Tc is observed, which is quite interesting for Pr substituted high Tc oxides. Maximum Tc ~ 58 K has been observed for x = 0.5(La-2125 stoichiometry). The results of structural studies and superconducting property measurements are presented in light of increase in Tc in LaPrCaBCO system with increasing Pr concentration.Comment: 6 pages including 5 figures and 1 tabl

    Using Light Curves to Characterize Size and Shape of Pseudo-Debris

    Get PDF
    Photometric measurements were collected for a new study aimed at estimating orbital debris sizes based on object brightness. To obtain a size from optical measurements the current practice is to assume an albedo and use a normalized magnitude to calculate optical size. However, assuming a single albedo value may not be valid for all objects or orbit types; material type and orientation can mask an object s true optical cross section. This experiment used a CCD camera to record data, a 300 W Xenon, Ozone Free collimated light source to simulate solar illumination, and a robotic arm with five degrees of freedom to move the piece of simulated debris through various orientations. The pseudo-debris pieces used in this experiment originate from the European Space Operations Centre s ESOC2 ground test explosion of a mock satellite. A uniformly illuminated white ping-pong ball was used as a zero-magnitude reference. Each debris piece was then moved through specific orientations and rotations to generate a light curve. This paper discusses the results of five different object-based light curves as measured through an x-rotation. Intensity measurements, from which each light curve was generated, were recorded in five degree increments from zero to 180 degrees. Comparing light curves of different shaped and sized pieces against their characteristic length establishes the start of a database from which an optical size estimation model will be derived in the future

    Cluster: Mission Overview and End-of-Life Analysis

    Get PDF
    The Cluster mission is part of the scientific programme of the European Space Agency (ESA) and its purpose is the analysis of the Earth's magnetosphere. The Cluster project consists of four satellites. The selected polar orbit has a shape of 4.0 and 19.2 Re which is required for performing measurements near the cusp and the tail of the magnetosphere. When crossing these regions the satellites form a constellation which in most of the cases so far has been a regular tetrahedron. The satellite operations are carried out by the European Space Operations Centre (ESOC) at Darmstadt, Germany. The paper outlines the future orbit evolution and the envisaged operations from a Flight Dynamics point of view. In addition a brief summary of the LEOP and routine operations is included beforehand

    Cleaning Genesis Solar Wind Collectors with Ultrapure Water: Residual Contaminant Particle Analysis

    Get PDF
    Additional experience has been gained in removing contaminant particles from the surface of Genesis solar wind collectors fragments by using megasonically activated ultrapure water (UPW)[1]. The curatorial facility has cleaned six of the eight array collector material types to date: silicon (Si), sapphire (SAP), silicon-on-sapphire (SOS), diamond-like carbon-on-silicon (DOS), gold-on-sapphire (AuOS), and germanium (Ge). Here we make estimates of cleaning effectiveness using image analysis of particle size distributions and an SEM/EDS reconnaissance of particle chemistry on the surface of UPW-cleaned silicon fragments (Fig. 1). Other particle removal techniques are reported by [2] and initial assessment of molecular film removal is reported by [3]
    corecore