153 research outputs found
Recommended from our members
TRIM39-RPP21 Variants (∆19InsCCC) Are Not Associated with Juvenile Idiopathic Epilepsy in Egyptian Arabian Horses.
Juvenile idiopathic epilepsy (JIE) is an inherited disease characterized by recurrent seizures during the first year of life in Egyptian Arabian horses. Definitive diagnosis requires an electroencephalogram (EEG) performed by a veterinary specialist. A recent study has suggested that a 19 base-pair deletion, along with a triple-C insertion, in intron five of twelve (∆19InsCCC; chr20:29542397-29542425: GTTCAGGGGACCACATGGCTCTCTATAGA>TATCTTAAGACCC) of the Tripartite Motif-Containing 39-Ribonuclease p/mrp 21kDa Subunit (TRIM39-RPP21) gene is associated with JIE. To confirm this association, a new sample set consisting of nine EEG-phenotyped affected and nine unaffected Egyptian Arabian horses were genotyped using Sanger sequencing. There was no significant genotypic (P = 1.00) or allelic (P = 0.31) association with the ∆19InsCCC variant and JIE status. The previously reported markers in TRIM39-RPPB1 are therefore not associated with JIE in well-phenotyped samples. The ∆19InsCCC variant is a common variant that happens to be positioned in a highly polymorphic region in the Arabian breed
The Tree Biodiversity Network (BIOTREE-NET): prospects for biodiversity research and conservation in the Neotropics
Biodiversity research and conservation efforts in the tropics are hindered by the lack of knowledge of the assemblages found there, with many species undescribed or poorly known. Our initiative, the Tree Biodiversity Network (BIOTREE-NET), aims to address this problem by assembling georeferenced data from a wide range of sources, making these data easily accessible and easily queried, and promoting data sharing. The database (GIVD ID NA-00-002) currently comprises ca. 50,000 tree records of ca. 5,000 species (230 in the IUCN Red List) from \u3e2,000 forest plots in 11 countries. The focus is on trees because of their pivotal role in tropical forest ecosystems (which contain most of the world\u27s biodiversity) in terms of ecosystem function, carbon storage and effects on other species. BIOTREE-NET currently focuses on southern Mexico and Central America, but we aim to expand coverage to other parts of tropical America. The database is relational, comprising 12 linked data tables. We summarise its structure and contents. Key tables contain data on forest plots (including size, location and date(s) sampled), individual trees (including diameter, when available, and both recorded and standardised species name), species (including biological traits of each species) and the researchers who collected the data. Many types of queries are facilitated and species distribution modelling is enabled. Examining the data in BIOTREE-NET to date, we found an uneven distribution of data in space and across biomes, reflecting the general state of knowledge of the tropics. More than 90% of the data were collected since 1990 and plot size varies widely, but with most less than one hectare in size. A wide range of minimum sizes is used to define a \u27tree\u27. The database helps to identify gaps that need filling by further data collection and collation. The data can be publicly accessed through a web application at http://portal.biotreenet.com. Researchers are invited and encouraged to contribute data to BIOTREE-NET
Recommended from our members
Constrained pre-equalization accounting for multi-path fading emulated using large RC networks: applications to wireless and photonics communications
Multi-path propagation is modelled assuming a multi-layer RC network with randomly allocated resistors and capacitors to represent the transmission medium. Due to frequency-selective attenuation, the waveforms associated with each propagation path incur path-dependent distortion. A pre-equalization procedure that takes into account the capabilities of the transmission source as well as the transmission properties of the medium is developed. The problem is cast within a Mixed Integer Linear Programming optimization framework that uses the developed nominal RC network model, with the excitation waveform customized to optimize signal fidelity from the transmitter to the receiver. The objective is to match a Gaussian pulse input accounting for frequency regions where there would be pronounced fading. Simulations are carried out with different network realizations in order to evaluate the sensitivity of the solution with respect to changes in the transmission medium mimicking the multi-path propagation. The proposed approach is of relevance where equalization techniques are difficult to implement. Applications are discussed within the context of emergent communication modalities across the EM spectrum such as light percolation as well as emergent indoor communications assuming various modulation protocols or UWB schemes as well as within the context of space division multiplexing
Evenness mediates the global relationship between forest productivity and richness
1. Biodiversity is an important component of natural ecosystems, with higher species richness often correlating with an increase in ecosystem productivity. Yet, this relationship varies substantially across environments, typically becoming less pronounced at high levels of species richness. However, species richness alone cannot reflect all important properties of a community, including community evenness, which may mediate the relationship between biodiversity and productivity. If the evenness of a community correlates negatively with richness across forests globally, then a greater number of species may not always increase overall diversity and productivity of the system. Theoretical work and local empirical studies have shown that the effect of evenness on ecosystem functioning may be especially strong at high richness levels, yet the consistency of this remains untested at a global scale.
2. Here, we used a dataset of forests from across the globe, which includes composition, biomass accumulation and net primary productivity, to explore whether productivity correlates with community evenness and richness in a way that evenness appears to buffer the effect of richness. Specifically, we evaluated whether low levels of evenness in speciose communities correlate with the attenuation of the richness–productivity relationship.
3. We found that tree species richness and evenness are negatively correlated across forests globally, with highly speciose forests typically comprising a few dominant and many rare species. Furthermore, we found that the correlation between diversity and productivity changes with evenness: at low richness, uneven communities are more productive, while at high richness, even communities are more productive.
4. Synthesis. Collectively, these results demonstrate that evenness is an integral component of the relationship between biodiversity and productivity, and that the attenuating effect of richness on forest productivity might be partly explained by low evenness in speciose communities. Productivity generally increases with species richness, until reduced evenness limits the overall increases in community diversity. Our research suggests that evenness is a fundamental component of biodiversity–ecosystem function relationships, and is of critical importance for guiding conservation and sustainable ecosystem management decisions
Evenness mediates the global relationship between forest productivity and richness
1. Biodiversity is an important component of natural ecosystems, with higher species richness often correlating with an increase in ecosystem productivity. Yet, this relationship varies substantially across environments, typically becoming less pronounced at high levels of species richness. However, species richness alone cannot reflect all important properties of a community, including community evenness, which may mediate the relationship between biodiversity and productivity. If the evenness of a community correlates negatively with richness across forests globally, then a greater number of species may not always increase overall diversity and productivity of the system. Theoretical work and local empirical studies have shown that the effect of evenness on ecosystem functioning may be especially strong at high richness levels, yet the consistency of this remains untested at a global scale. 2. Here, we used a dataset of forests from across the globe, which includes composition, biomass accumulation and net primary productivity, to explore whether productivity correlates with community evenness and richness in a way that evenness appears to buffer the effect of richness. Specifically, we evaluated whether low levels of evenness in speciose communities correlate with the attenuation of the richness–productivity relationship. 3. We found that tree species richness and evenness are negatively correlated across forests globally, with highly speciose forests typically comprising a few dominant and many rare species. Furthermore, we found that the correlation between diversity and productivity changes with evenness: at low richness, uneven communities are more productive, while at high richness, even communities are more productive. 4. Synthesis. Collectively, these results demonstrate that evenness is an integral component of the relationship between biodiversity and productivity, and that the attenuating effect of richness on forest productivity might be partly explained by low evenness in speciose communities. Productivity generally increases with species richness, until reduced evenness limits the overall increases in community diversity. Our research suggests that evenness is a fundamental component of biodiversity–ecosystem function relationships, and is of critical importance for guiding conservation and sustainable ecosystem management decisions
Native diversity buffers against severity of non-native tree invasions
Determining the drivers of non-native plant invasions is critical for managing native ecosystems and limiting the spread of invasive species. Tree invasions in particular have been relatively overlooked, even though they have the potential to transform ecosystems and economies. Here, leveraging global tree databases, we explore how the phylogenetic and functional diversity of native tree communities, human pressure and the environment influence the establishment of non-native tree species and the subsequent invasion severity. We find that anthropogenic factors are key to predicting whether a location is invaded, but that invasion severity is underpinned by native diversity, with higher diversity predicting lower invasion severity. Temperature and precipitation emerge as strong predictors of invasion strategy, with non-native species invading successfully when they are similar to the native community in cold or dry extremes. Yet, despite the influence of these ecological forces in determining invasion strategy, we find evidence that these patterns can be obscured by human activity, with lower ecological signal in areas with higher proximity to shipping ports. Our global perspective of non-native tree invasion highlights that human drivers influence non-native tree presence, and that native phylogenetic and functional diversity have a critical role in the establishment and spread of subsequent invasions
The global biogeography of tree leaf form and habit
Understanding what controls global leaf type variation in trees is crucial for comprehending their role in terrestrial ecosystems, including carbon, water and nutrient dynamics. Yet our understanding of the factors influencing forest leaf types remains incomplete, leaving us uncertain about the global proportions of needle-leaved, broadleaved, evergreen and deciduous trees. To address these gaps, we conducted a global, ground-sourced assessment of forest leaf-type variation by integrating forest inventory data with comprehensive leaf form (broadleaf vs needle-leaf) and habit (evergreen vs deciduous) records. We found that global variation in leaf habit is primarily driven by isothermality and soil characteristics, while leaf form is predominantly driven by temperature. Given these relationships, we estimate that 38% of global tree individuals are needle-leaved evergreen, 29% are broadleaved evergreen, 27% are broadleaved deciduous and 5% are needle-leaved deciduous. The aboveground biomass distribution among these tree types is approximately 21% (126.4 Gt), 54% (335.7 Gt), 22% (136.2 Gt) and 3% (18.7 Gt), respectively. We further project that, depending on future emissions pathways, 17-34% of forested areas will experience climate conditions by the end of the century that currently support a different forest type, highlighting the intensification of climatic stress on existing forests. By quantifying the distribution of tree leaf types and their corresponding biomass, and identifying regions where climate change will exert greatest pressure on current leaf types, our results can help improve predictions of future terrestrial ecosystem functioning and carbon cycling
The global biogeography of tree leaf form and habit.
Understanding what controls global leaf type variation in trees is crucial for comprehending their role in terrestrial ecosystems, including carbon, water and nutrient dynamics. Yet our understanding of the factors influencing forest leaf types remains incomplete, leaving us uncertain about the global proportions of needle-leaved, broadleaved, evergreen and deciduous trees. To address these gaps, we conducted a global, ground-sourced assessment of forest leaf-type variation by integrating forest inventory data with comprehensive leaf form (broadleaf vs needle-leaf) and habit (evergreen vs deciduous) records. We found that global variation in leaf habit is primarily driven by isothermality and soil characteristics, while leaf form is predominantly driven by temperature. Given these relationships, we estimate that 38% of global tree individuals are needle-leaved evergreen, 29% are broadleaved evergreen, 27% are broadleaved deciduous and 5% are needle-leaved deciduous. The aboveground biomass distribution among these tree types is approximately 21% (126.4 Gt), 54% (335.7 Gt), 22% (136.2 Gt) and 3% (18.7 Gt), respectively. We further project that, depending on future emissions pathways, 17-34% of forested areas will experience climate conditions by the end of the century that currently support a different forest type, highlighting the intensification of climatic stress on existing forests. By quantifying the distribution of tree leaf types and their corresponding biomass, and identifying regions where climate change will exert greatest pressure on current leaf types, our results can help improve predictions of future terrestrial ecosystem functioning and carbon cycling
- …